BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3064721.2.2
(595 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CB892201.1|CB892201 EST649170 KV3 Medicago truncatula cD... 44 0.013
gb|AC155898.15| Medicago truncatula clone mth2-109f1, compl... 40 0.21
gb|AC158737.14| Medicago truncatula clone mth2-154f20, comp... 40 0.21
>gb|CB892201.1|CB892201 EST649170 KV3 Medicago truncatula cDNA clone KV3-53D13, mRNA
sequence
Length = 822
Score = 44.1 bits (22), Expect = 0.013
Identities = 55/66 (83%)
Strand = Plus / Minus
Query: 9 tttgatttgggcgactggagaaagcaaaacatcactgaggtctaccatacctggcagaag 68
|||||||| | ||| |||| |||||||||||||| ||||| ||||| | |||||||||
Sbjct: 514 tttgatttagtcgaatggaagaagcaaaacatcacagaggtgtaccacaattggcagaag 455
Query: 69 ttgaat 74
|||||
Sbjct: 454 ctgaat 449
>gb|AC155898.15| Medicago truncatula clone mth2-109f1, complete sequence
Length = 93173
Score = 40.1 bits (20), Expect = 0.21
Identities = 50/60 (83%)
Strand = Plus / Plus
Query: 9 tttgatttgggcgactggagaaagcaaaacatcactgaggtctaccatacctggcagaag 68
|||||||| | ||| |||| |||||||||||||| ||||| ||||| | |||||||||
Sbjct: 45184 tttgatttagtcgaatggaagaagcaaaacatcacagaggtgtaccacaattggcagaag 45243
>gb|AC158737.14| Medicago truncatula clone mth2-154f20, complete sequence
Length = 114538
Score = 40.1 bits (20), Expect = 0.21
Identities = 50/60 (83%)
Strand = Plus / Plus
Query: 9 tttgatttgggcgactggagaaagcaaaacatcactgaggtctaccatacctggcagaag 68
|||||||| | ||| |||| |||||||||||||| ||||| ||||| | |||||||||
Sbjct: 986 tttgatttagtcgaatggaagaagcaaaacatcacagaggtgtaccacaattggcagaag 1045
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 165,500
Number of Sequences: 392609
Number of extensions: 165500
Number of successful extensions: 12044
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 12030
Number of HSP's gapped (non-prelim): 14
length of query: 595
length of database: 441,732,993
effective HSP length: 19
effective length of query: 576
effective length of database: 434,273,422
effective search space: 250141491072
effective search space used: 250141491072
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)