BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3064721.2.1
(689 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BI271827.1|BI271827 NF012D10FL1F1089 Developing flower M... 68 1e-009
gb|BI309958.1|BI309958 EST5311708 GESD Medicago truncatula ... 66 4e-009
gb|AC147014.24| Medicago truncatula clone mth2-164l15, WORK... 66 4e-009
gb|CA919688.1|CA919688 EST637406 MTUS Medicago truncatula c... 48 0.001
gb|CB892201.1|CB892201 EST649170 KV3 Medicago truncatula cD... 44 0.015
gb|BF650423.1|BF650423 NF088D03EC1F1028 Elicited cell cultu... 40 0.24
>gb|BI271827.1|BI271827 NF012D10FL1F1089 Developing flower Medicago truncatula cDNA clone
NF012D10FL 5', mRNA sequence
Length = 685
Score = 67.9 bits (34), Expect = 1e-009
Identities = 37/38 (97%)
Strand = Plus / Plus
Query: 3 atgcttgtggttgggcatatggcatgaacatgtttgat 40
||||||||||||||||||||||||||||||| ||||||
Sbjct: 460 atgcttgtggttgggcatatggcatgaacatatttgat 497
>gb|BI309958.1|BI309958 EST5311708 GESD Medicago truncatula cDNA clone pGESD4L15 5' end,
mRNA sequence
Length = 731
Score = 65.9 bits (33), Expect = 4e-009
Identities = 39/41 (95%)
Strand = Plus / Plus
Query: 3 atgcttgtggttgggcatatggcatgaacatgtttgatttg 43
||||||||||||||||||| || ||||||||||||||||||
Sbjct: 234 atgcttgtggttgggcatacggaatgaacatgtttgatttg 274
>gb|AC147014.24| Medicago truncatula clone mth2-164l15, WORKING DRAFT SEQUENCE
Length = 127679
Score = 65.9 bits (33), Expect = 4e-009
Identities = 39/41 (95%)
Strand = Plus / Minus
Query: 3 atgcttgtggttgggcatatggcatgaacatgtttgatttg 43
||||||||||||||||||| || ||||||||||||||||||
Sbjct: 87224 atgcttgtggttgggcatacggaatgaacatgtttgatttg 87184
>gb|CA919688.1|CA919688 EST637406 MTUS Medicago truncatula cDNA clone MTUS-16F9, mRNA
sequence
Length = 756
Score = 48.1 bits (24), Expect = 0.001
Identities = 33/36 (91%)
Strand = Plus / Minus
Query: 8 tgtggttgggcatatggcatgaacatgtttgatttg 43
|||| |||||| |||||||||||||| |||||||||
Sbjct: 661 tgtgcttgggcctatggcatgaacatttttgatttg 626
>gb|CB892201.1|CB892201 EST649170 KV3 Medicago truncatula cDNA clone KV3-53D13, mRNA
sequence
Length = 822
Score = 44.1 bits (22), Expect = 0.015
Identities = 81/98 (82%), Gaps = 2/98 (2%)
Strand = Plus / Minus
Query: 4 tgcttgtggttgggcatatggcatgaacatgtttgattt-gtctgggtggagaaagcaaa 62
||||||||| ||||||||||| ||||| | |||||||| ||| | |||| |||||||
Sbjct: 545 tgcttgtggatgggcatatggtatgaatgtttttgatttagtc-gaatggaagaagcaaa 487
Query: 63 acatcaccgaggtctaccatacctggcagaagttgaat 100
||||||| ||||| ||||| | ||||||||| |||||
Sbjct: 486 acatcacagaggtgtaccacaattggcagaagctgaat 449
>gb|BF650423.1|BF650423 NF088D03EC1F1028 Elicited cell culture Medicago truncatula cDNA
clone NF088D03EC 5', mRNA sequence
Length = 645
Score = 40.1 bits (20), Expect = 0.24
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 3 atgcttgtggttgggcatatggcatgaa 30
|||| ||||||||||||| |||||||||
Sbjct: 116 atgcatgtggttgggcatttggcatgaa 143
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 177,654
Number of Sequences: 392609
Number of extensions: 177654
Number of successful extensions: 12191
Number of sequences better than 0.5: 6
Number of HSP's better than 0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 12177
Number of HSP's gapped (non-prelim): 14
length of query: 689
length of database: 441,732,993
effective HSP length: 19
effective length of query: 670
effective length of database: 434,273,422
effective search space: 290963192740
effective search space used: 290963192740
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)