BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2950290.2.1
(1442 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CA919200.1|CA919200 EST636918 MTUS Medicago truncatula c... 56 9e-006
gb|AC137668.18| Medicago truncatula clone mth2-5f8, complet... 56 9e-006
gb|AQ917251.1|AQ917251 T233225b Medicago truncatula BAC lib... 50 5e-004
gb|CG930421.1|CG930421 MBEMF32TF mth2 Medicago truncatula g... 50 5e-004
gb|CG951032.1|CG951032 MBENG85TR mth2 Medicago truncatula g... 50 5e-004
gb|BF632526.1|BF632526 NF027A08DT1F1054 Drought Medicago tr... 50 5e-004
gb|BF634915.1|BF634915 NF076B05DT1F1044 Drought Medicago tr... 50 5e-004
gb|BF644746.1|BF644746 NF015A05EC1F1036 Elicited cell cultu... 50 5e-004
gb|CF068616.1|CF068616 EST669337 MTUS Medicago truncatula c... 50 5e-004
gb|BQ165576.1|BQ165576 EST611445 KVKC Medicago truncatula c... 44 0.033
gb|BQ165577.1|BQ165577 EST611446 KVKC Medicago truncatula c... 44 0.033
>gb|CA919200.1|CA919200 EST636918 MTUS Medicago truncatula cDNA clone MTUS-10C11, mRNA
sequence
Length = 718
Score = 56.0 bits (28), Expect = 9e-006
Identities = 43/48 (89%)
Strand = Plus / Minus
Query: 913 actttgattaccttttttatgttgaccttgaagcatcaatggctgatc 960
|||||||||| ||||| |||||||| ||||||| |||||||||||||
Sbjct: 631 actttgattatcttttctatgttgattttgaagcctcaatggctgatc 584
>gb|AC137668.18| Medicago truncatula clone mth2-5f8, complete sequence
Length = 133085
Score = 56.0 bits (28), Expect = 9e-006
Identities = 43/48 (89%)
Strand = Plus / Plus
Query: 913 actttgattaccttttttatgttgaccttgaagcatcaatggctgatc 960
|||||||||| ||||| |||||||| ||||||| |||||||||||||
Sbjct: 68463 actttgattatcttttctatgttgattttgaagcctcaatggctgatc 68510
Score = 50.1 bits (25), Expect = 5e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 337 ttgagaattcattgggaggtagcat 361
|||||||||||||||||||||||||
Sbjct: 66706 ttgagaattcattgggaggtagcat 66730
>gb|AQ917251.1|AQ917251 T233225b Medicago truncatula BAC library Medicago truncatula
genomic clone 45H24, DNA sequence
Length = 577
Score = 50.1 bits (25), Expect = 5e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 337 ttgagaattcattgggaggtagcat 361
|||||||||||||||||||||||||
Sbjct: 122 ttgagaattcattgggaggtagcat 98
>gb|CG930421.1|CG930421 MBEMF32TF mth2 Medicago truncatula genomic clone 1E16, DNA sequence
Length = 823
Score = 50.1 bits (25), Expect = 5e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 337 ttgagaattcattgggaggtagcat 361
|||||||||||||||||||||||||
Sbjct: 119 ttgagaattcattgggaggtagcat 95
>gb|CG951032.1|CG951032 MBENG85TR mth2 Medicago truncatula genomic clone 7P1, DNA sequence
Length = 934
Score = 50.1 bits (25), Expect = 5e-004
Identities = 25/25 (100%)
Strand = Plus / Minus
Query: 337 ttgagaattcattgggaggtagcat 361
|||||||||||||||||||||||||
Sbjct: 127 ttgagaattcattgggaggtagcat 103
>gb|BF632526.1|BF632526 NF027A08DT1F1054 Drought Medicago truncatula cDNA clone NF027A08DT
5', mRNA sequence
Length = 566
Score = 50.1 bits (25), Expect = 5e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 337 ttgagaattcattgggaggtagcat 361
|||||||||||||||||||||||||
Sbjct: 488 ttgagaattcattgggaggtagcat 512
>gb|BF634915.1|BF634915 NF076B05DT1F1044 Drought Medicago truncatula cDNA clone NF076B05DT
5', mRNA sequence
Length = 674
Score = 50.1 bits (25), Expect = 5e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 337 ttgagaattcattgggaggtagcat 361
|||||||||||||||||||||||||
Sbjct: 220 ttgagaattcattgggaggtagcat 244
Score = 46.1 bits (23), Expect = 0.008
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 486 agtcatccccaggctcttgcgcaatgtgagcacac 520
|||||||| ||||||||||| ||||||||| ||||
Sbjct: 369 agtcatccacaggctcttgcacaatgtgagaacac 403
>gb|BF644746.1|BF644746 NF015A05EC1F1036 Elicited cell culture Medicago truncatula cDNA
clone NF015A05EC 5', mRNA sequence
Length = 675
Score = 50.1 bits (25), Expect = 5e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 337 ttgagaattcattgggaggtagcat 361
|||||||||||||||||||||||||
Sbjct: 482 ttgagaattcattgggaggtagcat 506
>gb|CF068616.1|CF068616 EST669337 MTUS Medicago truncatula cDNA clone MTUS-10C11, mRNA
sequence
Length = 765
Score = 50.1 bits (25), Expect = 5e-004
Identities = 25/25 (100%)
Strand = Plus / Plus
Query: 337 ttgagaattcattgggaggtagcat 361
|||||||||||||||||||||||||
Sbjct: 397 ttgagaattcattgggaggtagcat 421
Score = 46.1 bits (23), Expect = 0.008
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 486 agtcatccccaggctcttgcgcaatgtgagcacac 520
|||||||| ||||||||||| ||||||||| ||||
Sbjct: 546 agtcatccacaggctcttgcacaatgtgagaacac 580
>gb|BQ165576.1|BQ165576 EST611445 KVKC Medicago truncatula cDNA clone pKVKC-10C2, mRNA
sequence
Length = 836
Score = 44.1 bits (22), Expect = 0.033
Identities = 43/50 (86%)
Strand = Plus / Plus
Query: 813 gtatttgcactgagggacatcaacctcacaaagattgaaagtcgtccaca 862
||||||||| |||||||||| || | || |||||||||||||| |||||
Sbjct: 444 gtatttgcaatgagggacataaatttaaccaagattgaaagtcgcccaca 493
>gb|BQ165577.1|BQ165577 EST611446 KVKC Medicago truncatula cDNA clone pKVKC-10C2, mRNA
sequence
Length = 707
Score = 44.1 bits (22), Expect = 0.033
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 813 gtatttgcactgagggacatcaacctcacaaagattgaaagtcgtccaca 862
||||||||| |||||||||| || | || |||||||||||||| |||||
Sbjct: 425 gtatttgcaatgagggacataaatttaaccaagattgaaagtcgcccaca 376
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 335,356
Number of Sequences: 392609
Number of extensions: 335356
Number of successful extensions: 24442
Number of sequences better than 0.5: 11
Number of HSP's better than 0.5 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24404
Number of HSP's gapped (non-prelim): 38
length of query: 1442
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1422
effective length of database: 433,880,813
effective search space: 616978516086
effective search space used: 616978516086
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)