BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2943856.2.2
(661 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AC137819.19| Medicago truncatula clone mth2-21i24, compl... 46 0.004
gb|AW560728.1|AW560728 EST315776 DSIR Medicago truncatula c... 42 0.058
gb|AW561000.1|AW561000 EST316048 DSIR Medicago truncatula c... 42 0.058
gb|AW561001.1|AW561001 EST316049 DSIR Medicago truncatula c... 42 0.058
gb|AW776484.1|AW776484 EST335549 DSIL Medicago truncatula c... 42 0.058
gb|AW127401.2|AW127401 M110584 DSIL Medicago truncatula cDN... 42 0.058
gb|AW981466.1|AW981466 EST392619 DSIL Medicago truncatula c... 42 0.058
gb|BE124066.1|BE124066 EST394191 DSIL Medicago truncatula c... 42 0.058
gb|BE204785.1|BE204785 EST397461 KV0 Medicago truncatula cD... 42 0.058
gb|AL375073.1|AL375073 MtBB11B10F1 MtBB Medicago truncatula... 42 0.058
gb|BE998030.1|BE998030 EST429753 GVSN Medicago truncatula c... 42 0.058
gb|BE998031.1|BE998031 EST429754 GVSN Medicago truncatula c... 42 0.058
gb|BE998478.1|BE998478 EST430201 GVSN Medicago truncatula c... 42 0.058
gb|BF519537.1|BF519537 EST457001 DSIL Medicago truncatula c... 42 0.058
gb|BF519805.1|BF519805 EST457269 DSIL Medicago truncatula c... 42 0.058
gb|BF521006.1|BF521006 EST458479 DSIL Medicago truncatula c... 42 0.058
gb|BF638910.1|BF638910 NF063A05PL1F1035 Phosphate starved l... 42 0.058
gb|BF644227.1|BF644227 NF060G01EC1F1005 Elicited cell cultu... 42 0.058
gb|BF644321.1|BF644321 NF063A07EC1F1052 Elicited cell cultu... 42 0.058
gb|BF645076.1|BF645076 NF034D04EC1F1041 Elicited cell cultu... 42 0.058
gb|BF646811.1|BF646811 NF073H07EC1F1063 Elicited cell cultu... 42 0.058
gb|BF646859.1|BF646859 NF066F01EC1F1013 Elicited cell cultu... 42 0.058
gb|BE248130.2|BE248130 NF001G07DT1F1052 Drought Medicago tr... 42 0.058
gb|BE323849.2|BE323849 NF009B06PL1F1045 Phosphate starved l... 42 0.058
gb|BG455691.1|BG455691 NF065B08PL1F1063 Phosphate starved l... 42 0.058
gb|BG647865.1|BG647865 EST509484 HOGA Medicago truncatula c... 42 0.058
gb|BI263882.1|BI263882 NF092A05PL1F1037 Phosphate starved l... 42 0.058
gb|BI265365.1|BI265365 NF095D11IN1F1094 Insect herbivory Me... 42 0.058
gb|AJ502589.1|AJ502589 AJ502589 MTAMP Medicago truncatula c... 42 0.058
gb|CF069899.1|CF069899 EST670620 MTUS Medicago truncatula c... 42 0.058
gb|AJ845369.1|AJ845369 AJ845369 MtSNF Medicago truncatula c... 42 0.058
gb|CX528169.1|CX528169 s13dNF52E06AT051_516850 Aphid-Infect... 42 0.058
gb|CX535116.1|CX535116 s13dNF84C05MJ038_388410 Methyl Jasmo... 42 0.058
gb|AC174331.4| Medicago truncatula clone mth2-145k5, WORKIN... 42 0.058
gb|AC151949.18| Medicago truncatula clone mth2-51e2, WORKIN... 42 0.058
gb|BE187635.1|BE187635 EST336196 KV0 Medicago truncatula cD... 40 0.23
gb|BE325810.1|BE325810 NF020D03ST1F1027 Developing stem Med... 40 0.23
gb|BF644907.1|BF644907 NF017B03EC1F1028 Elicited cell cultu... 40 0.23
gb|AW693552.2|AW693552 NF067E05ST1F1038 Developing stem Med... 40 0.23
gb|BQ137110.1|BQ137110 NF067E05STT1F103 Developing stem Med... 40 0.23
gb|CX527813.1|CX527813 s13dNF47F06AT059_516138 Aphid-Infect... 40 0.23
gb|CX529115.1|CX529115 s13dNF42B05MJ041_244288 Methyl Jasmo... 40 0.23
gb|CX531251.1|CX531251 s13dNF24B12MJ094_248619 Methyl Jasmo... 40 0.23
gb|AC140022.11| Medicago truncatula clone mth2-11g20, compl... 40 0.23
gb|AC159223.1| Medicago truncatula chromosome unknown clone... 40 0.23
gb|AC150979.15| Medicago truncatula clone mth2-115a17, comp... 40 0.23
>gb|AC137819.19| Medicago truncatula clone mth2-21i24, complete sequence
Length = 116989
Score = 46.1 bits (23), Expect = 0.004
Identities = 26/27 (96%)
Strand = Plus / Minus
Query: 366 ttctttattttcgttcttcttcttctt 392
|||||||||||| ||||||||||||||
Sbjct: 49262 ttctttattttctttcttcttcttctt 49236
>gb|AW560728.1|AW560728 EST315776 DSIR Medicago truncatula cDNA clone pDSIR-28I21, mRNA
sequence
Length = 159
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 80 ttcttcttcttcttcgtcaac 100
>gb|AW561000.1|AW561000 EST316048 DSIR Medicago truncatula cDNA clone pDSIR-31E1, mRNA
sequence
Length = 692
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 344 ttcttcttcttcttcgtcaac 364
>gb|AW561001.1|AW561001 EST316049 DSIR Medicago truncatula cDNA clone pDSIR-31E3, mRNA
sequence
Length = 756
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 341 ttcttcttcttcttcgtcaac 361
>gb|AW776484.1|AW776484 EST335549 DSIL Medicago truncatula cDNA clone pDSIL-8E5, mRNA
sequence
Length = 683
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 361 ttcttcttcttcttcgtcaac 381
>gb|AW127401.2|AW127401 M110584 DSIL Medicago truncatula cDNA clone IL114, mRNA sequence
Length = 365
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 306 ttcttcttcttcttcgtcaac 326
>gb|AW981466.1|AW981466 EST392619 DSIL Medicago truncatula cDNA clone pDSIL-16L21, mRNA
sequence
Length = 666
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 358 ttcttcttcttcttcgtcaac 378
>gb|BE124066.1|BE124066 EST394191 DSIL Medicago truncatula cDNA clone pDSIL-13A5, mRNA
sequence
Length = 601
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 345 ttcttcttcttcttcgtcaac 365
>gb|BE204785.1|BE204785 EST397461 KV0 Medicago truncatula cDNA clone pKV0-18M12, mRNA
sequence
Length = 601
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 335 ttcttcttcttcttcgtcaac 355
>gb|AL375073.1|AL375073 MtBB11B10F1 MtBB Medicago truncatula cDNA clone MtBB11B10 T3, mRNA
sequence
Length = 493
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 360 ttcttcttcttcttcgtcaac 380
>gb|BE998030.1|BE998030 EST429753 GVSN Medicago truncatula cDNA clone pGVSN-8L3, mRNA
sequence
Length = 607
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 365 ttcttcttcttcttcgtcaac 385
>gb|BE998031.1|BE998031 EST429754 GVSN Medicago truncatula cDNA clone pGVSN-8L3, mRNA
sequence
Length = 641
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 340 ttcttcttcttcttcgtcaac 360
>gb|BE998478.1|BE998478 EST430201 GVSN Medicago truncatula cDNA clone pGVSN-12G1, mRNA
sequence
Length = 495
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 302 ttcttcttcttcttcgtcaac 322
>gb|BF519537.1|BF519537 EST457001 DSIL Medicago truncatula cDNA clone pDSIL-21C1, mRNA
sequence
Length = 534
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 342 ttcttcttcttcttcgtcaac 362
>gb|BF519805.1|BF519805 EST457269 DSIL Medicago truncatula cDNA clone pDSIL-21B18, mRNA
sequence
Length = 593
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 319 ttcttcttcttcttcgtcaac 339
>gb|BF521006.1|BF521006 EST458479 DSIL Medicago truncatula cDNA clone pDSIL-41G17, mRNA
sequence
Length = 433
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 372 ttcttcttcttcttcgtcaac 392
>gb|BF638910.1|BF638910 NF063A05PL1F1035 Phosphate starved leaf Medicago truncatula cDNA
clone NF063A05PL 5', mRNA sequence
Length = 466
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 356 ttcttcttcttcttcgtcaac 376
>gb|BF644227.1|BF644227 NF060G01EC1F1005 Elicited cell culture Medicago truncatula cDNA
clone NF060G01EC 5', mRNA sequence
Length = 528
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 127 ttcttcttcttcttcgtcaac 147
>gb|BF644321.1|BF644321 NF063A07EC1F1052 Elicited cell culture Medicago truncatula cDNA
clone NF063A07EC 5', mRNA sequence
Length = 463
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 372 ttcttcttcttcttcgtcaac 392
>gb|BF645076.1|BF645076 NF034D04EC1F1041 Elicited cell culture Medicago truncatula cDNA
clone NF034D04EC 5', mRNA sequence
Length = 449
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 373 ttcttcttcttcttcgtcaac 393
>gb|BF646811.1|BF646811 NF073H07EC1F1063 Elicited cell culture Medicago truncatula cDNA
clone NF073H07EC 5', mRNA sequence
Length = 646
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 360 ttcttcttcttcttcgtcaac 380
>gb|BF646859.1|BF646859 NF066F01EC1F1013 Elicited cell culture Medicago truncatula cDNA
clone NF066F01EC 5', mRNA sequence
Length = 533
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 364 ttcttcttcttcttcgtcaac 384
>gb|BE248130.2|BE248130 NF001G07DT1F1052 Drought Medicago truncatula cDNA clone NF001G07DT
5', mRNA sequence
Length = 374
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 354 ttcttcttcttcttcgtcaac 374
>gb|BE323849.2|BE323849 NF009B06PL1F1045 Phosphate starved leaf Medicago truncatula cDNA
clone NF009B06PL 5', mRNA sequence
Length = 421
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 364 ttcttcttcttcttcgtcaac 384
>gb|BG455691.1|BG455691 NF065B08PL1F1063 Phosphate starved leaf Medicago truncatula cDNA
clone NF065B08PL 5', mRNA sequence
Length = 670
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 364 ttcttcttcttcttcgtcaac 384
>gb|BG647865.1|BG647865 EST509484 HOGA Medicago truncatula cDNA clone pHOGA-18I23 5' end,
mRNA sequence
Length = 444
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 27 ttcttcttcttcttcgtcaac 47
>gb|BI263882.1|BI263882 NF092A05PL1F1037 Phosphate starved leaf Medicago truncatula cDNA
clone NF092A05PL 5', mRNA sequence
Length = 667
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 165 ttcttcttcttcttcgtcaac 185
>gb|BI265365.1|BI265365 NF095D11IN1F1094 Insect herbivory Medicago truncatula cDNA clone
NF095D11IN 5', mRNA sequence
Length = 648
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 341 ttcttcttcttcttcgtcaac 361
>gb|AJ502589.1|AJ502589 AJ502589 MTAMP Medicago truncatula cDNA clone mtgmadc120022g11,
mRNA sequence
Length = 576
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 384 ttcttcttcttcttcgtcaac 404
>gb|CF069899.1|CF069899 EST670620 MTUS Medicago truncatula cDNA clone MTUS-25E12, mRNA
sequence
Length = 805
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 343 ttcttcttcttcttcgtcaac 363
>gb|AJ845369.1|AJ845369 AJ845369 MtSNF Medicago truncatula cDNA clone MtNF02P06N1, mRNA
sequence
Length = 692
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 359 ttcttcttcttcttcgtcaac 339
>gb|CX528169.1|CX528169 s13dNF52E06AT051_516850 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 635
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 369 ttcttcttcttcttcgtcaac 389
>gb|CX535116.1|CX535116 s13dNF84C05MJ038_388410 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 632
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 49 ttcttcttcttcttcgtcaac 69
>gb|AC174331.4| Medicago truncatula clone mth2-145k5, WORKING DRAFT SEQUENCE, 16
unordered pieces
Length = 115323
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 32087 ttcttcttcttcttcgtcaac 32107
>gb|AC151949.18| Medicago truncatula clone mth2-51e2, WORKING DRAFT SEQUENCE, 15 unordered
pieces
Length = 113125
Score = 42.1 bits (21), Expect = 0.058
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 379 ttcttcttcttcttcgtcaac 399
|||||||||||||||||||||
Sbjct: 102032 ttcttcttcttcttcgtcaac 102052
>gb|BE187635.1|BE187635 EST336196 KV0 Medicago truncatula cDNA clone pKV0-16K15, mRNA
sequence
Length = 715
Score = 40.1 bits (20), Expect = 0.23
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 378 gttcttcttcttcttcgtcaacac 401
|||||||||||||||| |||||||
Sbjct: 110 gttcttcttcttcttcttcaacac 133
>gb|BE325810.1|BE325810 NF020D03ST1F1027 Developing stem Medicago truncatula cDNA clone
NF020D03ST 5', mRNA sequence
Length = 327
Score = 40.1 bits (20), Expect = 0.23
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 378 gttcttcttcttcttcgtcaacac 401
|||||||||||||||| |||||||
Sbjct: 132 gttcttcttcttcttcttcaacac 155
>gb|BF644907.1|BF644907 NF017B03EC1F1028 Elicited cell culture Medicago truncatula cDNA
clone NF017B03EC 5', mRNA sequence
Length = 675
Score = 40.1 bits (20), Expect = 0.23
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 378 gttcttcttcttcttcgtcaacac 401
|||||||||||||||| |||||||
Sbjct: 137 gttcttcttcttcttcttcaacac 160
>gb|AW693552.2|AW693552 NF067E05ST1F1038 Developing stem Medicago truncatula cDNA clone
NF067E05ST 5', mRNA sequence
Length = 627
Score = 40.1 bits (20), Expect = 0.23
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 378 gttcttcttcttcttcgtcaacac 401
|||||||||||||||| |||||||
Sbjct: 117 gttcttcttcttcttcttcaacac 140
>gb|BQ137110.1|BQ137110 NF067E05STT1F103 Developing stem Medicago truncatula cDNA clone
NF067E05ST 5', mRNA sequence
Length = 778
Score = 40.1 bits (20), Expect = 0.23
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 378 gttcttcttcttcttcgtcaacac 401
|||||||||||||||| |||||||
Sbjct: 234 gttcttcttcttcttcttcaacac 257
>gb|CX527813.1|CX527813 s13dNF47F06AT059_516138 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 631
Score = 40.1 bits (20), Expect = 0.23
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 378 gttcttcttcttcttcgtcaacac 401
|||||||||||||||| |||||||
Sbjct: 225 gttcttcttcttcttcttcaacac 248
>gb|CX529115.1|CX529115 s13dNF42B05MJ041_244288 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 544
Score = 40.1 bits (20), Expect = 0.23
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 378 gttcttcttcttcttcgtcaacac 401
|||||||||||||||| |||||||
Sbjct: 212 gttcttcttcttcttcttcaacac 235
>gb|CX531251.1|CX531251 s13dNF24B12MJ094_248619 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 383
Score = 40.1 bits (20), Expect = 0.23
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 378 gttcttcttcttcttcgtcaacac 401
|||||||||||||||| |||||||
Sbjct: 166 gttcttcttcttcttcttcaacac 189
>gb|AC140022.11| Medicago truncatula clone mth2-11g20, complete sequence
Length = 104305
Score = 40.1 bits (20), Expect = 0.23
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 374 tttcgttcttcttcttcttc 393
||||||||||||||||||||
Sbjct: 53387 tttcgttcttcttcttcttc 53368
>gb|AC159223.1| Medicago truncatula chromosome unknown clone mth2-38k24, ***
SEQUENCING IN PROGRESS ***
Length = 87792
Score = 40.1 bits (20), Expect = 0.23
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 378 gttcttcttcttcttcgtcaacac 401
|||||||||||||||| |||||||
Sbjct: 1378 gttcttcttcttcttcttcaacac 1355
>gb|AC150979.15| Medicago truncatula clone mth2-115a17, complete sequence
Length = 152779
Score = 40.1 bits (20), Expect = 0.23
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 378 gttcttcttcttcttcgtcaacac 401
|||||||||||||||| |||||||
Sbjct: 58950 gttcttcttcttcttcttcaacac 58927
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 210,976
Number of Sequences: 392609
Number of extensions: 210976
Number of successful extensions: 33517
Number of sequences better than 0.5: 46
Number of HSP's better than 0.5 without gapping: 46
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 33390
Number of HSP's gapped (non-prelim): 117
length of query: 661
length of database: 441,732,993
effective HSP length: 19
effective length of query: 642
effective length of database: 434,273,422
effective search space: 278803536924
effective search space used: 278803536924
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)