BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2921718.2.1
(649 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AC174282.4| Medicago truncatula clone mth2-18p3, WORKING... 46 0.004
gb|AC174294.6| Medicago truncatula clone mth2-71d8, WORKING... 46 0.004
gb|AC174327.5| Medicago truncatula clone mth2-108e23, WORKI... 44 0.014
emb|CR307277.1| mte1-28K15RM1 BAC end, cultivar Jemalong A1... 42 0.057
emb|CR320026.1| mte1-46A11RM1 BAC end, cultivar Jemalong A1... 42 0.057
gb|AC160013.10| Medicago truncatula clone mth2-162b23, WORK... 42 0.057
gb|AC153121.14| Medicago truncatula clone mth2-80o14, WORKI... 42 0.057
gb|CG943530.1|CG943530 MBEIP86TR mth2 Medicago truncatula g... 40 0.23
gb|CG944525.1|CG944525 MBEIP87TR mth2 Medicago truncatula g... 40 0.23
gb|AC144806.10| Medicago truncatula clone mth2-34h22, compl... 40 0.23
gb|AC138131.16| Medicago truncatula clone mth2-21h11, compl... 40 0.23
gb|AC142222.18| Medicago truncatula clone mth2-27d20, WORKI... 40 0.23
>gb|AC174282.4| Medicago truncatula clone mth2-18p3, WORKING DRAFT SEQUENCE, 9
unordered pieces
Length = 83063
Score = 46.1 bits (23), Expect = 0.004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 417 ccttgcattgcattgcattgcat 439
|||||||||||||||||||||||
Sbjct: 3702 ccttgcattgcattgcattgcat 3680
>gb|AC174294.6| Medicago truncatula clone mth2-71d8, WORKING DRAFT SEQUENCE, 10 unordered
pieces
Length = 151569
Score = 46.1 bits (23), Expect = 0.004
Identities = 23/23 (100%)
Strand = Plus / Minus
Query: 417 ccttgcattgcattgcattgcat 439
|||||||||||||||||||||||
Sbjct: 138527 ccttgcattgcattgcattgcat 138505
>gb|AC174327.5| Medicago truncatula clone mth2-108e23, WORKING DRAFT SEQUENCE, 6
unordered pieces
Length = 135539
Score = 44.1 bits (22), Expect = 0.014
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 420 tgcattgcattgcattgcatcgcatcgcat 449
|||||||||||||||||||| |||| ||||
Sbjct: 129870 tgcattgcattgcattgcattgcattgcat 129841
Score = 44.1 bits (22), Expect = 0.014
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 419 ttgcattgcattgcattgcatcgcat 444
||||||||||||||||||||| ||||
Sbjct: 129866 ttgcattgcattgcattgcattgcat 129841
>emb|CR307277.1| mte1-28K15RM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 723
Score = 42.1 bits (21), Expect = 0.057
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 419 ttgcattgcattgcattgcat 439
|||||||||||||||||||||
Sbjct: 472 ttgcattgcattgcattgcat 452
>emb|CR320026.1| mte1-46A11RM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 549
Score = 42.1 bits (21), Expect = 0.057
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 419 ttgcattgcattgcattgcat 439
|||||||||||||||||||||
Sbjct: 472 ttgcattgcattgcattgcat 452
>gb|AC160013.10| Medicago truncatula clone mth2-162b23, WORKING DRAFT SEQUENCE, 4
ordered pieces
Length = 117818
Score = 42.1 bits (21), Expect = 0.057
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 420 tgcattgcattgcattgcatc 440
|||||||||||||||||||||
Sbjct: 41215 tgcattgcattgcattgcatc 41235
>gb|AC153121.14| Medicago truncatula clone mth2-80o14, WORKING DRAFT SEQUENCE, 2 ordered
pieces
Length = 114814
Score = 42.1 bits (21), Expect = 0.057
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 419 ttgcattgcattgcattgcat 439
|||||||||||||||||||||
Sbjct: 53918 ttgcattgcattgcattgcat 53898
>gb|CG943530.1|CG943530 MBEIP86TR mth2 Medicago truncatula genomic clone 63P4, DNA sequence
Length = 886
Score = 40.1 bits (20), Expect = 0.23
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 420 tgcattgcattgcattgcat 439
||||||||||||||||||||
Sbjct: 413 tgcattgcattgcattgcat 432
>gb|CG944525.1|CG944525 MBEIP87TR mth2 Medicago truncatula genomic clone 63P6, DNA sequence
Length = 910
Score = 40.1 bits (20), Expect = 0.23
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 420 tgcattgcattgcattgcat 439
||||||||||||||||||||
Sbjct: 413 tgcattgcattgcattgcat 432
>gb|AC144806.10| Medicago truncatula clone mth2-34h22, complete sequence
Length = 124550
Score = 40.1 bits (20), Expect = 0.23
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 419 ttgcattgcattgcattgca 438
||||||||||||||||||||
Sbjct: 86697 ttgcattgcattgcattgca 86678
>gb|AC138131.16| Medicago truncatula clone mth2-21h11, complete sequence
Length = 127696
Score = 40.1 bits (20), Expect = 0.23
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 330 aggagatcaaatccagcatcctca 353
||||| ||||||||||||||||||
Sbjct: 67573 aggagctcaaatccagcatcctca 67550
>gb|AC142222.18| Medicago truncatula clone mth2-27d20, WORKING DRAFT SEQUENCE, 2 ordered
pieces
Length = 125675
Score = 40.1 bits (20), Expect = 0.23
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 419 ttgcattgcattgcattgca 438
||||||||||||||||||||
Sbjct: 101428 ttgcattgcattgcattgca 101447
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 150,364
Number of Sequences: 392609
Number of extensions: 150364
Number of successful extensions: 25872
Number of sequences better than 0.5: 12
Number of HSP's better than 0.5 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 25800
Number of HSP's gapped (non-prelim): 62
length of query: 649
length of database: 441,732,993
effective HSP length: 19
effective length of query: 630
effective length of database: 434,273,422
effective search space: 273592255860
effective search space used: 273592255860
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)