BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2763110.2.1
         (541 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CG936151.1|CG936151  MBELT60TR mth2 Medicago truncatula g...    46   0.003
gb|CG974446.1|CG974446  MBEIU52TR mth2 Medicago truncatula g...    46   0.003
emb|CR507771.1|  mth4-2H20RM1 BAC end, cultivar Jemalong A17...    46   0.003
gb|BF003407.1|BF003407  EST431905 KV1 Medicago truncatula cD...    40   0.19 

>gb|CG936151.1|CG936151 MBELT60TR mth2 Medicago truncatula genomic clone 82J24, DNA
           sequence
          Length = 326

 Score = 46.1 bits (23), Expect = 0.003
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 121 ttgggcaatgggaagggatccta 143
           |||||||||||||||||||||||
Sbjct: 53  ttgggcaatgggaagggatccta 75



>gb|CG974446.1|CG974446 MBEIU52TR mth2 Medicago truncatula genomic clone 65I7, DNA sequence
          Length = 931

 Score = 46.1 bits (23), Expect = 0.003
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 121 ttgggcaatgggaagggatccta 143
           |||||||||||||||||||||||
Sbjct: 53  ttgggcaatgggaagggatccta 75



>emb|CR507771.1| mth4-2H20RM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
           genomic survey sequence
          Length = 531

 Score = 46.1 bits (23), Expect = 0.003
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 121 ttgggcaatgggaagggatccta 143
           |||||||||||||||||||||||
Sbjct: 74  ttgggcaatgggaagggatccta 96



>gb|BF003407.1|BF003407 EST431905 KV1 Medicago truncatula cDNA clone pKV1-5D14, mRNA
           sequence
          Length = 787

 Score = 40.1 bits (20), Expect = 0.19
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 480 tgacatatattcagttcaaa 499
           ||||||||||||||||||||
Sbjct: 96  tgacatatattcagttcaaa 115



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 110,194
Number of Sequences: 392609
Number of extensions: 110194
Number of successful extensions: 8490
Number of sequences better than  0.5: 4
Number of HSP's better than  0.5 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 8486
Number of HSP's gapped (non-prelim): 4
length of query: 541
length of database: 441,732,993
effective HSP length: 19
effective length of query: 522
effective length of database: 434,273,422
effective search space: 226690726284
effective search space used: 226690726284
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)