BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2750929.2.1
(583 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|CR345859.1| mte1-8C19FM1 BAC end, cultivar Jemalong A17... 42 0.051
gb|CX535009.1|CX535009 s13dNF28E07MJ055_388200 Methyl Jasmo... 42 0.051
gb|CX542351.1|CX542351 s13dNF82H11GS094_468018 Germinating ... 42 0.051
emb|CR306369.1| mte1-26N23RM1 BAC end, cultivar Jemalong A1... 40 0.20
emb|CR512180.1| mth4-28P11FM1 BAC end, cultivar Jemalong A1... 40 0.20
emb|CR512181.1| mth4-28P11FM3 BAC end, cultivar Jemalong A1... 40 0.20
gb|AW695153.1|AW695153 NF092B12ST1F1096 Developing stem Med... 40 0.20
gb|AW696050.1|AW696050 NF101D06ST1F1057 Developing stem Med... 40 0.20
gb|BF005190.1|BF005190 EST433688 DSLC Medicago truncatula c... 40 0.20
gb|BF636142.1|BF636142 NF080F01DT1F1013 Drought Medicago tr... 40 0.20
gb|BF640101.1|BF640101 NF036H10IN1F1091 Insect herbivory Me... 40 0.20
gb|BF641397.1|BF641397 NF061H12IN1F1103 Insect herbivory Me... 40 0.20
gb|BF643542.1|BF643542 NF026A10EC1F1081 Elicited cell cultu... 40 0.20
gb|AW695729.2|AW695729 NF097H07ST1F1063 Developing stem Med... 40 0.20
gb|AW696785.2|AW696785 NF110H02ST1F1026 Developing stem Med... 40 0.20
gb|AW693871.2|AW693871 NF070A03ST1F1019 Developing stem Med... 40 0.20
gb|AW691591.2|AW691591 NF042D11ST1F1000 Developing stem Med... 40 0.20
gb|BG447984.1|BG447984 NF103H09EC1F1078 Elicited cell cultu... 40 0.20
gb|BG448160.1|BG448160 NF106D11EC1F1092 Elicited cell cultu... 40 0.20
gb|BG453405.1|BG453405 NF090G10LF1F1081 Developing leaf Med... 40 0.20
gb|BG645664.1|BG645664 EST507283 KV3 Medicago truncatula cD... 40 0.20
gb|BI266422.1|BI266422 NF097C01IN1F1006 Insect herbivory Me... 40 0.20
gb|BQ141425.1|BQ141425 NF019E02PH1F1019 Phoma-infected Medi... 40 0.20
gb|CB892361.1|CB892361 EST649330 KV3 Medicago truncatula cD... 40 0.20
gb|CX525328.1|CX525328 s13dNF18A04AT033_479290 Aphid-Infect... 40 0.20
gb|CX527213.1|CX527213 s13dNF41B10AT089_514938 Aphid-Infect... 40 0.20
gb|CX539245.1|CX539245 s13dNF62G09GS068_461750 Germinating ... 40 0.20
gb|DW015948.1|DW015948 EST1224909 MTY Medicago truncatula c... 40 0.20
gb|AC140849.8| Medicago truncatula clone mth2-17f20, comple... 40 0.20
gb|AC144806.10| Medicago truncatula clone mth2-34h22, compl... 40 0.20
gb|AC138131.16| Medicago truncatula clone mth2-21h11, compl... 40 0.20
gb|AC137552.11| Medicago truncatula clone mth2-9k5, complet... 40 0.20
gb|AC147877.10| Medicago truncatula clone mth2-9b13, comple... 40 0.20
gb|AC137823.45| Medicago truncatula clone mth2-14c17, compl... 40 0.20
gb|AC150205.5| Medicago truncatula clone mth2-72l17, comple... 40 0.20
gb|AC121239.34| Medicago truncatula clone mth1-8p19, comple... 40 0.20
gb|AC157501.1| Medicago truncatula chromosome 7 clone mte1-... 40 0.20
gb|AC142222.18| Medicago truncatula clone mth2-27d20, WORKI... 40 0.20
emb|CR955009.1| Medicago truncatula chromosome 5 clone mth2... 40 0.20
gb|AC136286.27| Medicago truncatula clone mth2-6c9, WORKING... 40 0.20
gb|AC151620.26| Medicago truncatula clone mth2-2p16, WORKIN... 40 0.20
gb|AC135462.21| Medicago truncatula clone mth2-35o17, compl... 40 0.20
gb|AC138063.10| Medicago truncatula clone mth2-12h1, comple... 40 0.20
emb|CT025840.2| Medicago truncatula chromosome 5 clone mth4... 40 0.20
emb|CT025534.4| M.truncatula DNA sequence from clone MTH2-1... 40 0.20
gb|AC146864.21| Medicago truncatula clone mth2-175n24, WORK... 40 0.20
gb|AC174278.7| Medicago truncatula clone mth2-9d14, WORKING... 40 0.20
>emb|CR345859.1| mte1-8C19FM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 609
Score = 42.1 bits (21), Expect = 0.051
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 559 accctgtaccatctcaagagccatc 583
||||| |||||||||||||||||||
Sbjct: 301 accctttaccatctcaagagccatc 325
>gb|CX535009.1|CX535009 s13dNF28E07MJ055_388200 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 338
Score = 42.1 bits (21), Expect = 0.051
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 73 gtctcactcactcactcactc 93
|||||||||||||||||||||
Sbjct: 8 gtctcactcactcactcactc 28
>gb|CX542351.1|CX542351 s13dNF82H11GS094_468018 Germinating Seed Medicago truncatula cDNA,
mRNA sequence
Length = 608
Score = 42.1 bits (21), Expect = 0.051
Identities = 24/25 (96%)
Strand = Plus / Plus
Query: 559 accctgtaccatctcaagagccatc 583
||||| |||||||||||||||||||
Sbjct: 36 accctttaccatctcaagagccatc 60
>emb|CR306369.1| mte1-26N23RM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 648
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 76 tcactcactcactcactccc 95
||||||||||||||||||||
Sbjct: 314 tcactcactcactcactccc 295
>emb|CR512180.1| mth4-28P11FM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 453
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 150 tctcactcactcactcactc 169
>emb|CR512181.1| mth4-28P11FM3 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 664
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 150 tctcactcactcactcactc 169
>gb|AW695153.1|AW695153 NF092B12ST1F1096 Developing stem Medicago truncatula cDNA clone
NF092B12ST 5', mRNA sequence
Length = 654
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 2 tctcactcactcactcactc 21
>gb|AW696050.1|AW696050 NF101D06ST1F1057 Developing stem Medicago truncatula cDNA clone
NF101D06ST 5', mRNA sequence
Length = 659
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 2 tctcactcactcactcactc 21
>gb|BF005190.1|BF005190 EST433688 DSLC Medicago truncatula cDNA clone pDSLC-31N5, mRNA
sequence
Length = 461
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 75 ctcactcactcactcactcc 94
||||||||||||||||||||
Sbjct: 46 ctcactcactcactcactcc 27
>gb|BF636142.1|BF636142 NF080F01DT1F1013 Drought Medicago truncatula cDNA clone NF080F01DT
5', mRNA sequence
Length = 683
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 563 tgtaccatctcaagagccat 582
||||||||||||||||||||
Sbjct: 35 tgtaccatctcaagagccat 54
>gb|BF640101.1|BF640101 NF036H10IN1F1091 Insect herbivory Medicago truncatula cDNA clone
NF036H10IN 5', mRNA sequence
Length = 486
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 35 tctcactcactcactcactc 54
>gb|BF641397.1|BF641397 NF061H12IN1F1103 Insect herbivory Medicago truncatula cDNA clone
NF061H12IN 5', mRNA sequence
Length = 664
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 563 tgtaccatctcaagagccat 582
||||||||||||||||||||
Sbjct: 455 tgtaccatctcaagagccat 474
>gb|BF643542.1|BF643542 NF026A10EC1F1081 Elicited cell culture Medicago truncatula cDNA
clone NF026A10EC 5', mRNA sequence
Length = 547
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 76 tcactcactcactcactccc 95
||||||||||||||||||||
Sbjct: 36 tcactcactcactcactccc 17
>gb|AW695729.2|AW695729 NF097H07ST1F1063 Developing stem Medicago truncatula cDNA clone
NF097H07ST 5', mRNA sequence
Length = 408
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactcc 94
||||||||||||||||||||
Sbjct: 12 ctcactcactcactcactcc 31
>gb|AW696785.2|AW696785 NF110H02ST1F1026 Developing stem Medicago truncatula cDNA clone
NF110H02ST 5', mRNA sequence
Length = 487
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 76 tcactcactcactcactccc 95
||||||||||||||||||||
Sbjct: 36 tcactcactcactcactccc 17
>gb|AW693871.2|AW693871 NF070A03ST1F1019 Developing stem Medicago truncatula cDNA clone
NF070A03ST 5', mRNA sequence
Length = 420
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactcc 94
||||||||||||||||||||
Sbjct: 100 ctcactcactcactcactcc 119
>gb|AW691591.2|AW691591 NF042D11ST1F1000 Developing stem Medicago truncatula cDNA clone
NF042D11ST 5', mRNA sequence
Length = 558
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 4 tctcactcactcactcactc 23
>gb|BG447984.1|BG447984 NF103H09EC1F1078 Elicited cell culture Medicago truncatula cDNA
clone NF103H09EC 5', mRNA sequence
Length = 680
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 76 tcactcactcactcactccc 95
||||||||||||||||||||
Sbjct: 32 tcactcactcactcactccc 13
>gb|BG448160.1|BG448160 NF106D11EC1F1092 Elicited cell culture Medicago truncatula cDNA
clone NF106D11EC 5', mRNA sequence
Length = 675
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 76 tcactcactcactcactccc 95
||||||||||||||||||||
Sbjct: 32 tcactcactcactcactccc 13
>gb|BG453405.1|BG453405 NF090G10LF1F1081 Developing leaf Medicago truncatula cDNA clone
NF090G10LF 5', mRNA sequence
Length = 667
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 563 tgtaccatctcaagagccat 582
||||||||||||||||||||
Sbjct: 289 tgtaccatctcaagagccat 308
>gb|BG645664.1|BG645664 EST507283 KV3 Medicago truncatula cDNA clone pKV3-46P16 5' end,
mRNA sequence
Length = 854
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 157 cactgccactgactgagcta 176
||||||||||||||||||||
Sbjct: 430 cactgccactgactgagcta 411
>gb|BI266422.1|BI266422 NF097C01IN1F1006 Insect herbivory Medicago truncatula cDNA clone
NF097C01IN 5', mRNA sequence
Length = 248
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactcc 94
||||||||||||||||||||
Sbjct: 58 ctcactcactcactcactcc 77
>gb|BQ141425.1|BQ141425 NF019E02PH1F1019 Phoma-infected Medicago truncatula cDNA clone
NF019E02PH 5', mRNA sequence
Length = 656
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactcc 94
||||||||||||||||||||
Sbjct: 33 ctcactcactcactcactcc 52
>gb|CB892361.1|CB892361 EST649330 KV3 Medicago truncatula cDNA clone KV3-54C1, mRNA
sequence
Length = 854
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 20 tctcactcactcactcactc 1
>gb|CX525328.1|CX525328 s13dNF18A04AT033_479290 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 571
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 11 tctcactcactcactcactc 30
>gb|CX527213.1|CX527213 s13dNF41B10AT089_514938 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 627
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 35 tctcactcactcactcactc 54
>gb|CX539245.1|CX539245 s13dNF62G09GS068_461750 Germinating Seed Medicago truncatula
cDNA, mRNA sequence
Length = 605
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 9 tctcactcactcactcactc 28
>gb|DW015948.1|DW015948 EST1224909 MTY Medicago truncatula cDNA clone MTYAB52, mRNA
sequence
Length = 884
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 157 cactgccactgactgagcta 176
||||||||||||||||||||
Sbjct: 453 cactgccactgactgagcta 434
>gb|AC140849.8| Medicago truncatula clone mth2-17f20, complete sequence
Length = 136131
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 39490 tctcactcactcactcactc 39471
>gb|AC144806.10| Medicago truncatula clone mth2-34h22, complete sequence
Length = 124550
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 75 ctcactcactcactcactcc 94
||||||||||||||||||||
Sbjct: 63465 ctcactcactcactcactcc 63446
>gb|AC138131.16| Medicago truncatula clone mth2-21h11, complete sequence
Length = 127696
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 124563 tctcactcactcactcactc 124582
>gb|AC137552.11| Medicago truncatula clone mth2-9k5, complete sequence
Length = 122089
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 67183 tctcactcactcactcactc 67164
>gb|AC147877.10| Medicago truncatula clone mth2-9b13, complete sequence
Length = 122251
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 30689 tctcactcactcactcactc 30708
>gb|AC137823.45| Medicago truncatula clone mth2-14c17, complete sequence
Length = 135139
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 76843 tctcactcactcactcactc 76824
>gb|AC150205.5| Medicago truncatula clone mth2-72l17, complete sequence
Length = 130555
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 104245 tctcactcactcactcactc 104264
>gb|AC121239.34| Medicago truncatula clone mth1-8p19, complete sequence
Length = 100985
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 76 tcactcactcactcactccc 95
||||||||||||||||||||
Sbjct: 29258 tcactcactcactcactccc 29239
>gb|AC157501.1| Medicago truncatula chromosome 7 clone mte1-27e16, *** SEQUENCING IN
PROGRESS ***, 12 unordered pieces
Length = 124106
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 55919 tctcactcactcactcactc 55938
>gb|AC142222.18| Medicago truncatula clone mth2-27d20, WORKING DRAFT SEQUENCE, 2 ordered
pieces
Length = 125675
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactcc 94
||||||||||||||||||||
Sbjct: 124660 ctcactcactcactcactcc 124679
>emb|CR955009.1| Medicago truncatula chromosome 5 clone mth2-38i20, COMPLETE SEQUENCE
Length = 123473
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 75 ctcactcactcactcactcc 94
||||||||||||||||||||
Sbjct: 17195 ctcactcactcactcactcc 17214
>gb|AC136286.27| Medicago truncatula clone mth2-6c9, WORKING DRAFT SEQUENCE, 2 ordered
pieces
Length = 127639
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 157 cactgccactgactgagcta 176
||||||||||||||||||||
Sbjct: 40919 cactgccactgactgagcta 40900
>gb|AC151620.26| Medicago truncatula clone mth2-2p16, WORKING DRAFT SEQUENCE, 3 ordered
pieces
Length = 109154
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 107767 tctcactcactcactcactc 107748
>gb|AC135462.21| Medicago truncatula clone mth2-35o17, complete sequence
Length = 118385
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 36342 tctcactcactcactcactc 36323
>gb|AC138063.10| Medicago truncatula clone mth2-12h1, complete sequence
Length = 104547
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 83904 tctcactcactcactcactc 83923
>emb|CT025840.2| Medicago truncatula chromosome 5 clone mth4-39c23, COMPLETE SEQUENCE
Length = 243542
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 563 tgtaccatctcaagagccat 582
||||||||||||||||||||
Sbjct: 23206 tgtaccatctcaagagccat 23187
>emb|CT025534.4| M.truncatula DNA sequence from clone MTH2-1H4 on chromosome 3, complete
sequence
Length = 100991
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 76 tcactcactcactcactccc 95
||||||||||||||||||||
Sbjct: 29263 tcactcactcactcactccc 29244
>gb|AC146864.21| Medicago truncatula clone mth2-175n24, WORKING DRAFT SEQUENCE
Length = 113110
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 74 tctcactcactcactcactc 93
||||||||||||||||||||
Sbjct: 20645 tctcactcactcactcactc 20626
>gb|AC174278.7| Medicago truncatula clone mth2-9d14, WORKING DRAFT SEQUENCE, 24
unordered pieces
Length = 113275
Score = 40.1 bits (20), Expect = 0.20
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 75 ctcactcactcactcactcc 94
||||||||||||||||||||
Sbjct: 13864 ctcactcactcactcactcc 13845
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 129,008
Number of Sequences: 392609
Number of extensions: 129008
Number of successful extensions: 13455
Number of sequences better than 0.5: 47
Number of HSP's better than 0.5 without gapping: 47
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 13225
Number of HSP's gapped (non-prelim): 172
length of query: 583
length of database: 441,732,993
effective HSP length: 19
effective length of query: 564
effective length of database: 434,273,422
effective search space: 244930210008
effective search space used: 244930210008
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)