BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2591297.2.1
         (786 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AC162031.12|  Medicago truncatula clone mth2-194a22, comp...    40   0.27 

>gb|AC162031.12| Medicago truncatula clone mth2-194a22, complete sequence
          Length = 123712

 Score = 40.1 bits (20), Expect = 0.27
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 271   acacaacaataccataccatacatacat 298
             ||||||||| | ||||||||||||||||
Sbjct: 54371 acacaacaagatcataccatacatacat 54398



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 96,482
Number of Sequences: 392609
Number of extensions: 96482
Number of successful extensions: 6072
Number of sequences better than  0.5: 1
Number of HSP's better than  0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 6067
Number of HSP's gapped (non-prelim): 5
length of query: 786
length of database: 441,732,993
effective HSP length: 20
effective length of query: 766
effective length of database: 433,880,813
effective search space: 332352702758
effective search space used: 332352702758
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)