BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2591297.2.1
(786 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AC162031.12| Medicago truncatula clone mth2-194a22, comp... 40 0.27
>gb|AC162031.12| Medicago truncatula clone mth2-194a22, complete sequence
Length = 123712
Score = 40.1 bits (20), Expect = 0.27
Identities = 26/28 (92%)
Strand = Plus / Plus
Query: 271 acacaacaataccataccatacatacat 298
||||||||| | ||||||||||||||||
Sbjct: 54371 acacaacaagatcataccatacatacat 54398
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 96,482
Number of Sequences: 392609
Number of extensions: 96482
Number of successful extensions: 6072
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 6067
Number of HSP's gapped (non-prelim): 5
length of query: 786
length of database: 441,732,993
effective HSP length: 20
effective length of query: 766
effective length of database: 433,880,813
effective search space: 332352702758
effective search space used: 332352702758
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)