BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2568371.2.1
         (782 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AW774908.1|AW774908  EST334059 KV3 Medicago truncatula cD...    40   0.27 
gb|BM780126.1|BM780126  EST590702 KV2 Medicago truncatula cD...    40   0.27 
gb|AC155894.4|  Medicago truncatula chromosome 7 clone mth2-...    40   0.27 

>gb|AW774908.1|AW774908 EST334059 KV3 Medicago truncatula cDNA clone pKV3-24H19, mRNA
           sequence
          Length = 394

 Score = 40.1 bits (20), Expect = 0.27
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 337 tcgtcatgcatgcacatacc 356
           ||||||||||||||||||||
Sbjct: 328 tcgtcatgcatgcacatacc 309



>gb|BM780126.1|BM780126 EST590702 KV2 Medicago truncatula cDNA clone pKV2-54G5, mRNA
           sequence
          Length = 778

 Score = 40.1 bits (20), Expect = 0.27
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 337 tcgtcatgcatgcacatacc 356
           ||||||||||||||||||||
Sbjct: 439 tcgtcatgcatgcacatacc 420



>gb|AC155894.4| Medicago truncatula chromosome 7 clone mth2-67b7, *** SEQUENCING IN
             PROGRESS ***, 3 ordered pieces
          Length = 125354

 Score = 40.1 bits (20), Expect = 0.27
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 337   tcgtcatgcatgcacatacc 356
             ||||||||||||||||||||
Sbjct: 81387 tcgtcatgcatgcacatacc 81406



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 174,241
Number of Sequences: 392609
Number of extensions: 174241
Number of successful extensions: 14323
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14314
Number of HSP's gapped (non-prelim): 9
length of query: 782
length of database: 441,732,993
effective HSP length: 20
effective length of query: 762
effective length of database: 433,880,813
effective search space: 330617179506
effective search space used: 330617179506
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)