BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2521459.2.4
         (760 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CA923174.1|CA923174  EST640892 MTUS Medicago truncatula c...    42   0.067
gb|CA923195.1|CA923195  EST640913 MTUS Medicago truncatula c...    42   0.067
gb|BI309356.1|BI309356  EST530766 GPOD Medicago truncatula c...    40   0.27 
gb|BM780235.1|BM780235  EST590811 KV2 Medicago truncatula cD...    40   0.27 
gb|CA919619.1|CA919619  EST637337 MTUS Medicago truncatula c...    40   0.27 

>gb|CA923174.1|CA923174 EST640892 MTUS Medicago truncatula cDNA clone MTUS-64A11, mRNA
           sequence
          Length = 704

 Score = 42.1 bits (21), Expect = 0.067
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 442 tcttgaaacttggcctctgccacaaacttcccatagtggat 482
           ||||||||||| ||||| || ||||| || |||||||||||
Sbjct: 524 tcttgaaactttgcctcagcaacaaatttaccatagtggat 564



>gb|CA923195.1|CA923195 EST640913 MTUS Medicago truncatula cDNA clone MTUS-64D12, mRNA
           sequence
          Length = 803

 Score = 42.1 bits (21), Expect = 0.067
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                    
Query: 442 tcttgaaacttggcctctgccacaaacttcccatagtggat 482
           ||||||||||| ||||| || ||||| || |||||||||||
Sbjct: 525 tcttgaaactttgcctcagcaacaaatttaccatagtggat 565



>gb|BI309356.1|BI309356 EST530766 GPOD Medicago truncatula cDNA clone pGPOD-11O18 5' end,
           mRNA sequence
          Length = 567

 Score = 40.1 bits (20), Expect = 0.27
 Identities = 53/64 (82%)
 Strand = Plus / Minus

                                                                       
Query: 443 cttgaaacttggcctctgccacaaacttcccatagtggatccttctggagagtgcctgca 502
           ||||||| |||||||| || ||||| || ||||| ||||| ||  | ||||| |||||||
Sbjct: 492 cttgaaatttggcctcagcaacaaatttgccataatggattctctttgagagagcctgca 433

               
Query: 503 agca 506
           ||||
Sbjct: 432 agca 429



>gb|BM780235.1|BM780235 EST590811 KV2 Medicago truncatula cDNA clone pKV2-54M6, mRNA
           sequence
          Length = 818

 Score = 40.1 bits (20), Expect = 0.27
 Identities = 53/64 (82%)
 Strand = Plus / Plus

                                                                       
Query: 443 cttgaaacttggcctctgccacaaacttcccatagtggatccttctggagagtgcctgca 502
           ||||||| |||||||| || ||||| || ||||| ||||| ||  | ||||| |||||||
Sbjct: 475 cttgaaatttggcctcagcaacaaatttgccataatggattctctttgagagagcctgca 534

               
Query: 503 agca 506
           ||||
Sbjct: 535 agca 538



>gb|CA919619.1|CA919619 EST637337 MTUS Medicago truncatula cDNA clone MTUS-15H1, mRNA
           sequence
          Length = 606

 Score = 40.1 bits (20), Expect = 0.27
 Identities = 53/64 (82%)
 Strand = Plus / Plus

                                                                       
Query: 443 cttgaaacttggcctctgccacaaacttcccatagtggatccttctggagagtgcctgca 502
           ||||||| |||||||| || ||||| || ||||| ||||| ||  | ||||| |||||||
Sbjct: 455 cttgaaatttggcctcagcaacaaatttgccataatggattctctttgagagagcctgca 514

               
Query: 503 agca 506
           ||||
Sbjct: 515 agca 518



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 185,505
Number of Sequences: 392609
Number of extensions: 185505
Number of successful extensions: 14895
Number of sequences better than  0.5: 5
Number of HSP's better than  0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14890
Number of HSP's gapped (non-prelim): 5
length of query: 760
length of database: 441,732,993
effective HSP length: 20
effective length of query: 740
effective length of database: 433,880,813
effective search space: 321071801620
effective search space used: 321071801620
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)