BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2494085.2.4
(645 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AC169175.1| Medicago truncatula chromosome 2 clone mth2-... 42 0.057
gb|AC150441.2| Medicago truncatula chromosome 2 BAC clone m... 40 0.22
gb|AC153349.20| Medicago truncatula clone mth2-72p9, WORKIN... 40 0.22
gb|AC153350.13| Medicago truncatula clone mth2-77l10, WORKI... 40 0.22
gb|AC161789.7| Medicago truncatula clone mth2-116a3, WORKIN... 40 0.22
>gb|AC169175.1| Medicago truncatula chromosome 2 clone mth2-176l12, *** SEQUENCING IN
PROGRESS ***, 10 ordered pieces
Length = 135339
Score = 42.1 bits (21), Expect = 0.057
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 162 tatttaatattttaattcattaact 186
||||| |||||||||||||||||||
Sbjct: 63636 tattttatattttaattcattaact 63612
>gb|AC150441.2| Medicago truncatula chromosome 2 BAC clone mth2-19l4, complete sequence
Length = 120811
Score = 40.1 bits (20), Expect = 0.22
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 530 tttgagatggaacggaatggaatg 553
|||||||||||| |||||||||||
Sbjct: 102337 tttgagatggaatggaatggaatg 102314
>gb|AC153349.20| Medicago truncatula clone mth2-72p9, WORKING DRAFT SEQUENCE, 2
ordered pieces
Length = 104337
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 159 tattatttaatattttaatt 178
||||||||||||||||||||
Sbjct: 2647 tattatttaatattttaatt 2628
>gb|AC153350.13| Medicago truncatula clone mth2-77l10, WORKING DRAFT SEQUENCE, 4 ordered
pieces
Length = 110967
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 536 atggaacggaatggaatgga 555
||||||||||||||||||||
Sbjct: 14356 atggaacggaatggaatgga 14337
>gb|AC161789.7| Medicago truncatula clone mth2-116a3, WORKING DRAFT SEQUENCE, 15
unordered pieces
Length = 75506
Score = 40.1 bits (20), Expect = 0.22
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 159 tattatttaatattttaatt 178
||||||||||||||||||||
Sbjct: 31101 tattatttaatattttaatt 31082
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 188,008
Number of Sequences: 392609
Number of extensions: 188008
Number of successful extensions: 29729
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 29663
Number of HSP's gapped (non-prelim): 66
length of query: 645
length of database: 441,732,993
effective HSP length: 19
effective length of query: 626
effective length of database: 434,273,422
effective search space: 271855162172
effective search space used: 271855162172
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)