BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2485944.3.1
(991 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AC123898.40| Medicago truncatula clone mth2-31m6, comple... 92 1e-016
gb|BE124289.1|BE124289 EST394414 DSIL Medicago truncatula c... 74 2e-011
emb|CR931741.1| Medicago truncatula chromosome 5 clone mte1... 74 2e-011
gb|AW981208.1|AW981208 EST392298 DSIL Medicago truncatula c... 66 6e-009
gb|BE123884.1|BE123884 EST394009 DSIL Medicago truncatula c... 66 6e-009
gb|BF521442.1|BF521442 EST458918 DSIL Medicago truncatula c... 66 6e-009
gb|BF638191.1|BF638191 NF028F08PL1F1073 Phosphate starved l... 66 6e-009
gb|CA917614.1|CA917614 EST641761 GPOD Medicago truncatula c... 66 6e-009
gb|CA918767.1|CA918767 EST636485 MTUS Medicago truncatula c... 66 6e-009
gb|CX526602.1|CX526602 s13dNF36F06AT059_513716 Aphid-Infect... 66 6e-009
gb|DW017235.1|DW017235 EST1226196 MTY Medicago truncatula c... 66 6e-009
gb|AC146790.16| Medicago truncatula clone mth2-123b21, comp... 66 6e-009
emb|CR317165.1| mte1-41F5FM1 BAC end, cultivar Jemalong A17... 62 9e-008
gb|CF068441.1|CF068441 EST669162 MTUS Medicago truncatula c... 62 9e-008
gb|BF639755.1|BF639755 NF018F12IN1F1103 Insect herbivory Me... 60 4e-007
gb|CX527007.1|CX527007 s13dNF39A02AT017_514526 Aphid-Infect... 60 4e-007
gb|BE240282.1|BE240282 EST404331 MHRP- Medicago truncatula ... 58 1e-006
gb|BG447629.1|BG447629 NF034G10ST1F1000 Developing stem Med... 58 1e-006
gb|AC153121.14| Medicago truncatula clone mth2-80o14, WORKI... 56 6e-006
gb|AL369377.1|AL369377 MtBA30F11R1 MtBA Medicago truncatula... 54 2e-005
gb|AW776649.1|AW776649 EST335714 DSIL Medicago truncatula c... 50 4e-004
gb|AW981164.1|AW981164 EST392358 DSIL Medicago truncatula c... 50 4e-004
gb|BF644800.1|BF644800 NF022H07EC1F1063 Elicited cell cultu... 50 4e-004
gb|BG648894.1|BG648894 EST510513 HOGA Medicago truncatula c... 50 4e-004
gb|CX530072.1|CX530072 s13dNF98G10MJ081_246180 Methyl Jasmo... 50 4e-004
gb|CX530185.1|CX530185 s13dNF53D03MJ027_246405 Methyl Jasmo... 50 4e-004
gb|CX530852.1|CX530852 s13dNF32A08MJ054_247856 Methyl Jasmo... 50 4e-004
gb|CX531796.1|CX531796 s13dNF87E10MJ071_257534 Methyl Jasmo... 50 4e-004
gb|CX531814.1|CX531814 s13dNF87H01MJ012_257570 Methyl Jasmo... 50 4e-004
gb|CX532109.1|CX532109 s13dNF64B04MJ029_270523 Methyl Jasmo... 50 4e-004
gb|CX533177.1|CX533177 s13dNF0CH03MJ028_319517 Methyl Jasmo... 50 4e-004
gb|CX533368.1|CX533368 s13dNF0IG11MJ084_319896 Methyl Jasmo... 50 4e-004
gb|CX534800.1|CX534800 s13dNF77H12MJ104_331291 Methyl Jasmo... 50 4e-004
gb|CX542316.1|CX542316 s13dNF82D05GS043_467948 Germinating ... 50 4e-004
gb|AW775567.1|AW775567 EST334632 DSIL Medicago truncatula c... 48 0.001
gb|BG646369.1|BG646369 EST507988 HOGA Medicago truncatula c... 48 0.001
gb|BQ158078.1|BQ158078 NF022C05PL1F1035 Phosphate starved l... 48 0.001
gb|CX530756.1|CX530756 s13dNF27E12MJ088_247527 Methyl Jasmo... 48 0.001
gb|DW018280.1|DW018280 EST1227241 MTY Medicago truncatula c... 48 0.001
gb|AW776209.1|AW776209 EST335274 DSIL Medicago truncatula c... 46 0.006
gb|BQ146448.1|BQ146448 NF084B05FL1F1045 Developing flower M... 46 0.006
gb|CF067998.1|CF067998 EST668719 MTUS Medicago truncatula c... 46 0.006
gb|CX522780.1|CX522780 s13dNF85A09VI069_471364 Virus-Infect... 46 0.006
gb|CX522803.1|CX522803 s13dNF85C09VI070_471410 Virus-Infect... 46 0.006
gb|CX535119.1|CX535119 s13dNF84C08MJ066_388416 Methyl Jasmo... 46 0.006
gb|AW689126.1|AW689126 NF015F08ST1F1000 Developing stem Med... 44 0.022
gb|AW981344.1|AW981344 EST392497 DSIL Medicago truncatula c... 44 0.022
gb|BF638114.1|BF638114 NF029A08PL1F1055 Phosphate starved l... 44 0.022
gb|CX518212.1|CX518212 s13dNF28D04VI030_422137 Virus-Infect... 44 0.022
gb|AW688883.1|AW688883 NF012G10ST1F1000 Developing stem Med... 42 0.088
gb|BF645529.1|BF645529 NF023A04EC1F1024 Elicited cell cultu... 42 0.088
gb|BE324445.2|BE324445 NF018D12PL1F1095 Phosphate starved l... 42 0.088
gb|BE240283.1|BE240283 EST404332 MHRP- Medicago truncatula ... 40 0.35
gb|BG646738.1|BG646738 EST508357 HOGA Medicago truncatula c... 40 0.35
gb|BG648409.1|BG648409 EST510028 HOGA Medicago truncatula c... 40 0.35
gb|AJ503703.1|AJ503703 AJ503703 MTAMP Medicago truncatula c... 40 0.35
gb|CB892983.1|CB892983 EST645775 HOGA Medicago truncatula c... 40 0.35
gb|CX530366.1|CX530366 s13dNF59H08MJ073_246765 Methyl Jasmo... 40 0.35
gb|CX531013.1|CX531013 s13dNF20F02MJ016_248166 Methyl Jasmo... 40 0.35
gb|CX531069.1|CX531069 s13dNF21D03MJ027_248277 Methyl Jasmo... 40 0.35
gb|CX532226.1|CX532226 s13dNF65G12MJ088_270748 Methyl Jasmo... 40 0.35
gb|CX532957.1|CX532957 s13dNF69E07MJ051_272194 Methyl Jasmo... 40 0.35
gb|CX533001.1|CX533001 s13dNF89B07MJ057_272280 Methyl Jasmo... 40 0.35
gb|CX533906.1|CX533906 s13dNF0AE02MJ007_321579 Methyl Jasmo... 40 0.35
gb|CX533935.1|CX533935 s13dNF0AH03MJ028_321635 Methyl Jasmo... 40 0.35
>gb|AC123898.40| Medicago truncatula clone mth2-31m6, complete sequence
Length = 152299
Score = 91.7 bits (46), Expect = 1e-016
Identities = 106/126 (84%)
Strand = Plus / Plus
Query: 840 tgtgctggaataaccgtgtatactccaatgatgcgacacaacatgaaccaacctggaaag 899
||||||||||| || || ||| |||| ||||||||||| || ||||| |||||||| |||
Sbjct: 94017 tgtgctggaatcactgtttattctcccatgatgcgacataatatgaatcaacctggtaag 94076
Query: 900 tcacttggggtcattggtcttggtggtctgggtcacatggctgtgaaatttggtaaagca 959
|| ||||| || ||||||||||||| || ||||| ||||| || |||||||| || |||
Sbjct: 94077 tctcttggagtggttggtcttggtggcctcggtcatatggcagtaaaatttgggaaggca 94136
Query: 960 tttggt 965
||||||
Sbjct: 94137 tttggt 94142
Score = 75.8 bits (38), Expect = 6e-012
Identities = 104/126 (82%)
Strand = Plus / Plus
Query: 840 tgtgctggaataaccgtgtatactccaatgatgcgacacaacatgaaccaacctggaaag 899
||||||||||| || || ||| |||| ||||| ||||| || ||||| ||||| || |||
Sbjct: 100229 tgtgctggaatcactgtttattctcccatgattcgacataatatgaatcaacccggcaag 100288
Query: 900 tcacttggggtcattggtcttggtggtctgggtcacatggctgtgaaatttggtaaagca 959
|| ||||| || ||||||||||||| || ||||| ||||| || |||||||| || |||
Sbjct: 100289 tctcttggagtggttggtcttggtggcctcggtcatatggcggtaaaatttgggaaggca 100348
Query: 960 tttggt 965
||||||
Sbjct: 100349 tttggt 100354
Score = 40.1 bits (20), Expect = 0.35
Identities = 29/32 (90%)
Strand = Plus / Plus
Query: 756 tactccactcacattgtagtccatgaaaggta 787
||||||||| ||||||||| |||||||||||
Sbjct: 99979 tactccacttccattgtagtacatgaaaggta 100010
>gb|BE124289.1|BE124289 EST394414 DSIL Medicago truncatula cDNA clone pDSIL-13J13, mRNA
sequence
Length = 562
Score = 73.8 bits (37), Expect = 2e-011
Identities = 49/53 (92%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttggtaaagcatttggt 965
||||||||||||| |||||||| |||||||||||||||| |||||| ||||||
Sbjct: 8 ttggtcttggtggactgggtcatatggctgtgaaatttgctaaagcttttggt 60
>emb|CR931741.1| Medicago truncatula chromosome 5 clone mte1-54m21, COMPLETE SEQUENCE
Length = 123541
Score = 73.8 bits (37), Expect = 2e-011
Identities = 49/53 (92%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttggtaaagcatttggt 965
||||||||||||| || |||||||||||||||||||||| ||||||||||||
Sbjct: 31101 ttggtcttggtgggcttggtcacatggctgtgaaatttgccaaagcatttggt 31153
Score = 65.9 bits (33), Expect = 6e-009
Identities = 48/53 (90%)
Strand = Plus / Minus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttggtaaagcatttggt 965
||||||||||||| || ||||| |||||||||||||||| |||||| ||||||
Sbjct: 88745 ttggtcttggtggacttggtcatatggctgtgaaatttgctaaagcttttggt 88693
Score = 65.9 bits (33), Expect = 6e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttggtaaagcatttggt 965
||||||||||||| || |||||||||||||||||||||| ||||| ||||||
Sbjct: 27280 ttggtcttggtgggcttggtcacatggctgtgaaatttgccaaagcttttggt 27332
Score = 50.1 bits (25), Expect = 4e-004
Identities = 34/37 (91%)
Strand = Plus / Minus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatt 949
||||||||||||| || ||||| ||||||||||||||
Sbjct: 68085 ttggtcttggtggacttggtcatatggctgtgaaatt 68049
Score = 50.1 bits (25), Expect = 4e-004
Identities = 31/33 (93%)
Strand = Plus / Minus
Query: 389 ttgggcagcgagagatccttctggagttctctc 421
||||||||| |||||||||||||| ||||||||
Sbjct: 62099 ttgggcagctagagatccttctggtgttctctc 62067
Score = 50.1 bits (25), Expect = 4e-004
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 389 ttgggcagcgagagatccttctggagttctctc 421
||||||||| |||||||||||||| ||||||||
Sbjct: 49623 ttgggcagctagagatccttctggtgttctctc 49655
Score = 48.1 bits (24), Expect = 0.001
Identities = 30/32 (93%)
Strand = Plus / Minus
Query: 390 tgggcagcgagagatccttctggagttctctc 421
|||||||| |||||||||||||| ||||||||
Sbjct: 56571 tgggcagctagagatccttctggtgttctctc 56540
Score = 46.1 bits (23), Expect = 0.006
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttg 951
||||||||||||| || || || ||||||||||||||||
Sbjct: 61194 ttggtcttggtggacttggccatatggctgtgaaatttg 61156
Score = 46.1 bits (23), Expect = 0.006
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttg 951
||||||||||||| || || || ||||||||||||||||
Sbjct: 54849 ttggtcttggtggacttggccatatggctgtgaaatttg 54811
Score = 44.1 bits (22), Expect = 0.022
Identities = 34/38 (89%)
Strand = Plus / Minus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaattt 950
||||||||||||| | ||||| |||||||||||||||
Sbjct: 14936 ttggtcttggtggattaggtcatatggctgtgaaattt 14899
Score = 42.1 bits (21), Expect = 0.088
Identities = 51/61 (83%)
Strand = Plus / Minus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttggtaaagcatttggtcttaagg 972
||||||||||||| | ||||| ||||||||||| || | ||||| |||||| ||||||
Sbjct: 20732 ttggtcttggtggattaggtcatatggctgtgaagttcgccaaagcctttggtgttaagg 20673
Query: 973 t 973
|
Sbjct: 20672 t 20672
Score = 40.1 bits (20), Expect = 0.35
Identities = 44/52 (84%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttggtaaagcatttgg 964
||||||||||||| || |||||| ||| |||||| |||| ||||| |||||
Sbjct: 35508 ttggtcttggtggacttggtcacttgggtgtgaagtttgcaaaagcttttgg 35559
>gb|AW981208.1|AW981208 EST392298 DSIL Medicago truncatula cDNA clone pDSIL-12A7, mRNA
sequence
Length = 738
Score = 65.9 bits (33), Expect = 6e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttggtaaagcatttggt 965
||||||||||||| || ||||| |||||||||||||||| |||||| ||||||
Sbjct: 522 ttggtcttggtggacttggtcatatggctgtgaaatttgctaaagcttttggt 574
>gb|BE123884.1|BE123884 EST394009 DSIL Medicago truncatula cDNA clone pDSIL-11D7, mRNA
sequence
Length = 637
Score = 65.9 bits (33), Expect = 6e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttggtaaagcatttggt 965
||||||||||||| || ||||| |||||||||||||||| |||||| ||||||
Sbjct: 558 ttggtcttggtggacttggtcatatggctgtgaaatttgctaaagcttttggt 610
>gb|BF521442.1|BF521442 EST458918 DSIL Medicago truncatula cDNA clone pDSIL-43K14, mRNA
sequence
Length = 747
Score = 65.9 bits (33), Expect = 6e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttggtaaagcatttggt 965
||||||||||||| || ||||| |||||||||||||||| |||||| ||||||
Sbjct: 541 ttggtcttggtggacttggtcatatggctgtgaaatttgctaaagcttttggt 593
>gb|BF638191.1|BF638191 NF028F08PL1F1073 Phosphate starved leaf Medicago truncatula cDNA
clone NF028F08PL 5', mRNA sequence
Length = 760
Score = 65.9 bits (33), Expect = 6e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttggtaaagcatttggt 965
||||||||||||| || ||||| |||||||||||||||| |||||| ||||||
Sbjct: 665 ttggtcttggtggacttggtcatatggctgtgaaatttgctaaagcttttggt 717
>gb|CA917614.1|CA917614 EST641761 GPOD Medicago truncatula cDNA clone GPOD-36B14, mRNA
sequence
Length = 803
Score = 65.9 bits (33), Expect = 6e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttggtaaagcatttggt 965
||||||||||||| || ||||| |||||||||||||||| |||||| ||||||
Sbjct: 551 ttggtcttggtggacttggtcatatggctgtgaaatttgctaaagcttttggt 603
>gb|CA918767.1|CA918767 EST636485 MTUS Medicago truncatula cDNA clone MTUS-2H9, mRNA
sequence
Length = 725
Score = 65.9 bits (33), Expect = 6e-009
Identities = 48/53 (90%)
Strand = Plus / Minus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttggtaaagcatttggt 965
||||||||||||| || ||||| |||||||||||||||| |||||| ||||||
Sbjct: 489 ttggtcttggtggacttggtcatatggctgtgaaatttgctaaagcttttggt 437
>gb|CX526602.1|CX526602 s13dNF36F06AT059_513716 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 626
Score = 65.9 bits (33), Expect = 6e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttggtaaagcatttggt 965
||||||||||||| || ||||| |||||||||||||||| |||||| ||||||
Sbjct: 525 ttggtcttggtggacttggtcatatggctgtgaaatttgctaaagcttttggt 577
>gb|DW017235.1|DW017235 EST1226196 MTY Medicago truncatula cDNA clone MTYAR13, mRNA
sequence
Length = 762
Score = 65.9 bits (33), Expect = 6e-009
Identities = 48/53 (90%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttggtaaagcatttggt 965
||||||||||||| || ||||| |||||||||||||||| |||||| ||||||
Sbjct: 624 ttggtcttggtggacttggtcatatggctgtgaaatttgctaaagcttttggt 676
>gb|AC146790.16| Medicago truncatula clone mth2-123b21, complete sequence
Length = 114449
Score = 65.9 bits (33), Expect = 6e-009
Identities = 36/37 (97%)
Strand = Plus / Minus
Query: 930 ggtcacatggctgtgaaatttggtaaagcatttggtc 966
|||||||||||||| ||||||||||||||||||||||
Sbjct: 27276 ggtcacatggctgtaaaatttggtaaagcatttggtc 27240
Score = 42.1 bits (21), Expect = 0.088
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 825 gcagcacctcttctgtgtgctggaataac 853
||||||||||| || ||||||||||||||
Sbjct: 27384 gcagcacctctactctgtgctggaataac 27356
>emb|CR317165.1| mte1-41F5FM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 866
Score = 61.9 bits (31), Expect = 9e-008
Identities = 58/67 (86%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttggtaaagcatttggtcttaagg 972
||||||||||||| || ||||| |||||||||||||||| ||||| |||||| |||||
Sbjct: 409 ttggtcttggtggacttggtcatatggctgtgaaatttgccaaagcttttggtgctaagg 468
Query: 973 tcacagt 979
| |||||
Sbjct: 469 taacagt 475
>gb|CF068441.1|CF068441 EST669162 MTUS Medicago truncatula cDNA clone MTUS-8A6, mRNA
sequence
Length = 603
Score = 61.9 bits (31), Expect = 9e-008
Identities = 91/111 (81%)
Strand = Plus / Plus
Query: 840 tgtgctggaataaccgtgtatactccaatgatgcgacacaacatgaaccaacctggaaag 899
||||||||||| || || ||| |||| ||||| ||||| || ||||| ||||| || |||
Sbjct: 410 tgtgctggaatcactgtttattctcccatgattcgacataatatgaatcaacccggcaag 469
Query: 900 tcacttggggtcattggtcttggtggtctgggtcacatggctgtgaaattt 950
|| ||||| || ||||||||||||| || ||||| ||||| || ||||||
Sbjct: 470 tctcttggagtggttggtcttggtggcctcggtcatatggcggtaaaattt 520
Score = 54.0 bits (27), Expect = 2e-005
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 756 tactccactcacattgtagtccatgaaaggtattgcttc 794
||||||||| ||||||||| ||||||||||||||||||
Sbjct: 326 tactccacttccattgtagtacatgaaaggtattgcttc 364
>gb|BF639755.1|BF639755 NF018F12IN1F1103 Insect herbivory Medicago truncatula cDNA clone
NF018F12IN 5', mRNA sequence
Length = 618
Score = 60.0 bits (30), Expect = 4e-007
Identities = 42/46 (91%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttggtaaagc 958
||||||||||||| || ||||| |||||||||||||||| ||||||
Sbjct: 567 ttggtcttggtggacttggtcatatggctgtgaaatttgctaaagc 612
>gb|CX527007.1|CX527007 s13dNF39A02AT017_514526 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 614
Score = 60.0 bits (30), Expect = 4e-007
Identities = 33/34 (97%)
Strand = Plus / Minus
Query: 933 cacatggctgtgaaatttggtaaagcatttggtc 966
||||||||||| ||||||||||||||||||||||
Sbjct: 614 cacatggctgtaaaatttggtaaagcatttggtc 581
>gb|BE240282.1|BE240282 EST404331 MHRP- Medicago truncatula cDNA clone pMHRP-43D13, mRNA
sequence
Length = 313
Score = 58.0 bits (29), Expect = 1e-006
Identities = 47/53 (88%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttggtaaagcatttggt 965
||||||||||||| || ||||| |||||||||||||| || ||||| ||||||
Sbjct: 41 ttggtcttggtggacttggtcatatggctgtgaaattcggcaaagcttttggt 93
>gb|BG447629.1|BG447629 NF034G10ST1F1000 Developing stem Medicago truncatula cDNA clone
NF034G10ST 5', mRNA sequence
Length = 655
Score = 58.0 bits (29), Expect = 1e-006
Identities = 83/101 (82%)
Strand = Plus / Plus
Query: 840 tgtgctggaataaccgtgtatactccaatgatgcgacacaacatgaaccaacctggaaag 899
||||||||||| || || ||| |||| ||||| ||||| || ||||| ||||| || |||
Sbjct: 520 tgtgctggaatcactgtttattctcccatgattcgacataatatgaatcaacccggcaag 579
Query: 900 tcacttggggtcattggtcttggtggtctgggtcacatggc 940
|| ||||| || ||||||||||||| || ||||| |||||
Sbjct: 580 tctcttggagtggttggtcttggtggcctcggtcatatggc 620
Score = 54.0 bits (27), Expect = 2e-005
Identities = 36/39 (92%)
Strand = Plus / Plus
Query: 756 tactccactcacattgtagtccatgaaaggtattgcttc 794
||||||||| ||||||||| ||||||||||||||||||
Sbjct: 436 tactccacttccattgtagtacatgaaaggtattgcttc 474
>gb|AC153121.14| Medicago truncatula clone mth2-80o14, WORKING DRAFT SEQUENCE, 2 ordered
pieces
Length = 114814
Score = 56.0 bits (28), Expect = 6e-006
Identities = 46/52 (88%)
Strand = Plus / Minus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttggtaaagcatttgg 964
||||||||||||| || |||||||||||||| || |||| |||||| |||||
Sbjct: 68221 ttggtcttggtggacttggtcacatggctgttaagtttgctaaagcttttgg 68170
>gb|AL369377.1|AL369377 MtBA30F11R1 MtBA Medicago truncatula cDNA clone MtBA30F11 T7, mRNA
sequence
Length = 496
Score = 54.0 bits (27), Expect = 2e-005
Identities = 36/39 (92%)
Strand = Plus / Minus
Query: 756 tactccactcacattgtagtccatgaaaggtattgcttc 794
||||||||| ||||||||| ||||||||||||||||||
Sbjct: 48 tactccacttccattgtagtacatgaaaggtattgcttc 10
>gb|AW776649.1|AW776649 EST335714 DSIL Medicago truncatula cDNA clone pDSIL-11I13, mRNA
sequence
Length = 650
Score = 50.1 bits (25), Expect = 4e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatt 949
||||||||||||| || ||||| ||||||||||||||
Sbjct: 557 ttggtcttggtggacttggtcatatggctgtgaaatt 593
>gb|AW981164.1|AW981164 EST392358 DSIL Medicago truncatula cDNA clone pDSIL-12K19, mRNA
sequence
Length = 763
Score = 50.1 bits (25), Expect = 4e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatt 949
||||||||||||| || ||||| ||||||||||||||
Sbjct: 605 ttggtcttggtggacttggtcatatggctgtgaaatt 641
>gb|BF644800.1|BF644800 NF022H07EC1F1063 Elicited cell culture Medicago truncatula cDNA
clone NF022H07EC 5', mRNA sequence
Length = 663
Score = 50.1 bits (25), Expect = 4e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatt 949
||||||||||||| || ||||| ||||||||||||||
Sbjct: 605 ttggtcttggtggacttggtcatatggctgtgaaatt 641
>gb|BG648894.1|BG648894 EST510513 HOGA Medicago truncatula cDNA clone pHOGA-24M11 5' end,
mRNA sequence
Length = 776
Score = 50.1 bits (25), Expect = 4e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatt 949
||||||||||||| || ||||| ||||||||||||||
Sbjct: 118 ttggtcttggtggacttggtcatatggctgtgaaatt 154
>gb|CX530072.1|CX530072 s13dNF98G10MJ081_246180 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 673
Score = 50.1 bits (25), Expect = 4e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatt 949
||||||||||||| || ||||| ||||||||||||||
Sbjct: 182 ttggtcttggtggacttggtcatatggctgtgaaatt 218
>gb|CX530185.1|CX530185 s13dNF53D03MJ027_246405 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 635
Score = 50.1 bits (25), Expect = 4e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatt 949
||||||||||||| || ||||| ||||||||||||||
Sbjct: 497 ttggtcttggtggacttggtcatatggctgtgaaatt 533
>gb|CX530852.1|CX530852 s13dNF32A08MJ054_247856 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 655
Score = 50.1 bits (25), Expect = 4e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatt 949
||||||||||||| || ||||| ||||||||||||||
Sbjct: 118 ttggtcttggtggacttggtcatatggctgtgaaatt 154
>gb|CX531796.1|CX531796 s13dNF87E10MJ071_257534 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 628
Score = 50.1 bits (25), Expect = 4e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatt 949
||||||||||||| || ||||| ||||||||||||||
Sbjct: 190 ttggtcttggtggacttggtcatatggctgtgaaatt 226
>gb|CX531814.1|CX531814 s13dNF87H01MJ012_257570 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 590
Score = 50.1 bits (25), Expect = 4e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatt 949
||||||||||||| || ||||| ||||||||||||||
Sbjct: 514 ttggtcttggtggacttggtcatatggctgtgaaatt 550
>gb|CX532109.1|CX532109 s13dNF64B04MJ029_270523 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 650
Score = 50.1 bits (25), Expect = 4e-004
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 389 ttgggcagcgagagatccttctggagttctctc 421
||||||||| |||||||||||||| ||||||||
Sbjct: 48 ttgggcagctagagatccttctggtgttctctc 80
Score = 46.1 bits (23), Expect = 0.006
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttg 951
||||||||||||| || || || ||||||||||||||||
Sbjct: 572 ttggtcttggtggacttggccatatggctgtgaaatttg 610
>gb|CX533177.1|CX533177 s13dNF0CH03MJ028_319517 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 655
Score = 50.1 bits (25), Expect = 4e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatt 949
||||||||||||| || ||||| ||||||||||||||
Sbjct: 343 ttggtcttggtggacttggtcatatggctgtgaaatt 379
>gb|CX533368.1|CX533368 s13dNF0IG11MJ084_319896 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 637
Score = 50.1 bits (25), Expect = 4e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatt 949
||||||||||||| || ||||| ||||||||||||||
Sbjct: 281 ttggtcttggtggacttggtcatatggctgtgaaatt 317
>gb|CX534800.1|CX534800 s13dNF77H12MJ104_331291 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 228
Score = 50.1 bits (25), Expect = 4e-004
Identities = 31/33 (93%)
Strand = Plus / Plus
Query: 389 ttgggcagcgagagatccttctggagttctctc 421
||||||||| |||||||||||||| ||||||||
Sbjct: 49 ttgggcagctagagatccttctggtgttctctc 81
>gb|CX542316.1|CX542316 s13dNF82D05GS043_467948 Germinating Seed Medicago truncatula cDNA,
mRNA sequence
Length = 507
Score = 50.1 bits (25), Expect = 4e-004
Identities = 34/37 (91%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatt 949
||||||||||||| || ||||| ||||||||||||||
Sbjct: 3 ttggtcttggtggacttggtcatatggctgtgaaatt 39
>gb|AW775567.1|AW775567 EST334632 DSIL Medicago truncatula cDNA clone pDSIL-2O13, mRNA
sequence
Length = 692
Score = 48.1 bits (24), Expect = 0.001
Identities = 45/52 (86%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttggtaaagcatttgg 964
||||||||||||| || |||||| ||| ||||||||||| ||||| |||||
Sbjct: 636 ttggtcttggtggacttggtcacttgggtgtgaaatttgcaaaagcttttgg 687
>gb|BG646369.1|BG646369 EST507988 HOGA Medicago truncatula cDNA clone pHOGA-7I18 5' end,
mRNA sequence
Length = 673
Score = 48.1 bits (24), Expect = 0.001
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 914 tggtcttggtggtctgggtcacatggctgtgaaatt 949
|||||||||||| || ||||| ||||||||||||||
Sbjct: 601 tggtcttggtggacttggtcatatggctgtgaaatt 636
>gb|BQ158078.1|BQ158078 NF022C05PL1F1035 Phosphate starved leaf Medicago truncatula cDNA
clone NF022C05PL 5', mRNA sequence
Length = 1142
Score = 48.1 bits (24), Expect = 0.001
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 390 tgggcagcgagagatccttctggagttctctc 421
|||||||| |||||||||||||| ||||||||
Sbjct: 201 tgggcagctagagatccttctggtgttctctc 232
>gb|CX530756.1|CX530756 s13dNF27E12MJ088_247527 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 666
Score = 48.1 bits (24), Expect = 0.001
Identities = 33/36 (91%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaat 948
||||||||||||| || ||||| |||||||||||||
Sbjct: 631 ttggtcttggtggacttggtcatatggctgtgaaat 666
>gb|DW018280.1|DW018280 EST1227241 MTY Medicago truncatula cDNA clone MTYB456, mRNA
sequence
Length = 835
Score = 48.1 bits (24), Expect = 0.001
Identities = 30/32 (93%)
Strand = Plus / Plus
Query: 390 tgggcagcgagagatccttctggagttctctc 421
|||||||| |||||||||||||| ||||||||
Sbjct: 89 tgggcagctagagatccttctggtgttctctc 120
Score = 46.1 bits (23), Expect = 0.006
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttg 951
||||||||||||| || || || ||||||||||||||||
Sbjct: 612 ttggtcttggtggacttggccatatggctgtgaaatttg 650
>gb|AW776209.1|AW776209 EST335274 DSIL Medicago truncatula cDNA clone pDSIL-6L5, mRNA
sequence
Length = 402
Score = 46.1 bits (23), Expect = 0.006
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttg 951
||||||||||||| || || || ||||||||||||||||
Sbjct: 348 ttggtcttggtggacttggccatatggctgtgaaatttg 386
>gb|BQ146448.1|BQ146448 NF084B05FL1F1045 Developing flower Medicago truncatula cDNA clone
NF084B05FL 5', mRNA sequence
Length = 598
Score = 46.1 bits (23), Expect = 0.006
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttg 951
||||||||||||| || || || ||||||||||||||||
Sbjct: 340 ttggtcttggtggacttggccatatggctgtgaaatttg 378
>gb|CF067998.1|CF067998 EST668719 MTUS Medicago truncatula cDNA clone MTUS-2D9, mRNA
sequence
Length = 809
Score = 46.1 bits (23), Expect = 0.006
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttg 951
||||||||||||| || || || ||||||||||||||||
Sbjct: 329 ttggtcttggtggacttggccatatggctgtgaaatttg 367
>gb|CX522780.1|CX522780 s13dNF85A09VI069_471364 Virus-Infected Leaves Medicago truncatula
cDNA, mRNA sequence
Length = 546
Score = 46.1 bits (23), Expect = 0.006
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttg 951
||||||||||||| || || || ||||||||||||||||
Sbjct: 108 ttggtcttggtggacttggccatatggctgtgaaatttg 146
>gb|CX522803.1|CX522803 s13dNF85C09VI070_471410 Virus-Infected Leaves Medicago truncatula
cDNA, mRNA sequence
Length = 546
Score = 46.1 bits (23), Expect = 0.006
Identities = 35/39 (89%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttg 951
||||||||||||| || || || ||||||||||||||||
Sbjct: 108 ttggtcttggtggacttggccatatggctgtgaaatttg 146
>gb|CX535119.1|CX535119 s13dNF84C08MJ066_388416 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 595
Score = 46.1 bits (23), Expect = 0.006
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaa 947
||||||||||||| || ||||| ||||||||||||
Sbjct: 561 ttggtcttggtggacttggtcatatggctgtgaaa 595
>gb|AW689126.1|AW689126 NF015F08ST1F1000 Developing stem Medicago truncatula cDNA clone
NF015F08ST 5', mRNA sequence
Length = 491
Score = 44.1 bits (22), Expect = 0.022
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 758 ctccactcacattgtagtccatgaaaggtattgcttc 794
||||||| ||||||||| ||||||||| ||||||||
Sbjct: 442 ctccacttccattgtagtacatgaaaggnattgcttc 478
>gb|AW981344.1|AW981344 EST392497 DSIL Medicago truncatula cDNA clone pDSIL-12F14, mRNA
sequence
Length = 413
Score = 44.1 bits (22), Expect = 0.022
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 936 atggctgtgaaatttggtaaagcatttggt 965
|||||||||||||||| |||||| ||||||
Sbjct: 2 atggctgtgaaatttgctaaagcttttggt 31
>gb|BF638114.1|BF638114 NF029A08PL1F1055 Phosphate starved leaf Medicago truncatula cDNA
clone NF029A08PL 5', mRNA sequence
Length = 623
Score = 44.1 bits (22), Expect = 0.022
Identities = 41/46 (89%), Gaps = 1/46 (2%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaaatttggtaaagc 958
||||||||||||| || ||||| ||||||| |||||||| ||||||
Sbjct: 563 ttggtcttggtggacttggtcatatggctg-gaaatttgctaaagc 607
>gb|CX518212.1|CX518212 s13dNF28D04VI030_422137 Virus-Infected Leaves Medicago truncatula
cDNA, mRNA sequence
Length = 588
Score = 44.1 bits (22), Expect = 0.022
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 913 ttggtcttggtggtctgggtcacatggctgtgaa 946
||||||||||||| || ||||| |||||||||||
Sbjct: 555 ttggtcttggtggacttggtcatatggctgtgaa 588
>gb|AW688883.1|AW688883 NF012G10ST1F1000 Developing stem Medicago truncatula cDNA clone
NF012G10ST 5', mRNA sequence
Length = 617
Score = 42.1 bits (21), Expect = 0.088
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 825 gcagcacctcttctgtgtgctggaataac 853
||||||||||| || ||||||||||||||
Sbjct: 495 gcagcacctctactctgtgctggaataac 523
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 179,406
Number of Sequences: 392609
Number of extensions: 179406
Number of successful extensions: 12609
Number of sequences better than 0.5: 66
Number of HSP's better than 0.5 without gapping: 63
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 12497
Number of HSP's gapped (non-prelim): 115
length of query: 991
length of database: 441,732,993
effective HSP length: 20
effective length of query: 971
effective length of database: 433,880,813
effective search space: 421298269423
effective search space used: 421298269423
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)