BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2418946.2.1
(690 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AL381590.1|AL381590 MtBC01H02R2 MtBC Medicago truncatula... 62 7e-008
gb|AC152184.1| Medicago truncatula chromosome 7 BAC clone m... 62 7e-008
gb|AC122723.6| Medicago truncatula clone mth2-5i15, complet... 62 7e-008
emb|CR493732.1| mth2-143K5FM1 BAC end, cultivar Jemalong A1... 52 6e-005
emb|CT571260.1| Medicago truncatula chromosome 5 clone mth2... 40 0.24
>gb|AL381590.1|AL381590 MtBC01H02R2 MtBC Medicago truncatula cDNA clone MtBC01H02 T7, mRNA
sequence
Length = 548
Score = 61.9 bits (31), Expect = 7e-008
Identities = 52/59 (88%)
Strand = Plus / Plus
Query: 271 atgctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggaca 329
|||||||||||||| ||||||||||||||| |||| || || ||||| || ||||||||
Sbjct: 305 atgctgttcaaccaagcgttcagcagaggtttgcaaatttctcgtattcttggaggaca 363
>gb|AC152184.1| Medicago truncatula chromosome 7 BAC clone mte1-61c3, complete sequence
Length = 103090
Score = 61.9 bits (31), Expect = 7e-008
Identities = 52/59 (88%)
Strand = Plus / Plus
Query: 271 atgctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggaca 329
|||||||||||||| ||||||||||||||| |||| || || ||||| || ||||||||
Sbjct: 10096 atgctgttcaaccaagcgttcagcagaggtttgcaaatttctcgtattcttggaggaca 10154
>gb|AC122723.6| Medicago truncatula clone mth2-5i15, complete sequence
Length = 105353
Score = 61.9 bits (31), Expect = 7e-008
Identities = 52/59 (88%)
Strand = Plus / Plus
Query: 271 atgctgttcaaccaggcgttcagcagaggtctgcagatctcccgtatcctgggaggaca 329
|||||||||||||| ||||||||||||||| |||| || || ||||| || ||||||||
Sbjct: 81493 atgctgttcaaccaagcgttcagcagaggtttgcaaatttctcgtattcttggaggaca 81551
>emb|CR493732.1| mth2-143K5FM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 687
Score = 52.0 bits (26), Expect = 6e-005
Identities = 53/62 (85%)
Strand = Plus / Plus
Query: 238 tggttcccgttcgtgtcggaattccagaccaggatgctgttcaaccaggcgttcagcaga 297
|||||||| || || || |||||||| |||||| |||| |||||||| || |||||||||
Sbjct: 68 tggttcccatttgtttcagaattccaaaccaggctgctattcaaccaagcattcagcaga 127
Query: 298 gg 299
||
Sbjct: 128 gg 129
>emb|CT571260.1| Medicago truncatula chromosome 5 clone mth2-35p14, COMPLETE SEQUENCE
Length = 120436
Score = 40.1 bits (20), Expect = 0.24
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 411 tgtgtgaatgggtgggtagc 430
||||||||||||||||||||
Sbjct: 110977 tgtgtgaatgggtgggtagc 110958
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 134,320
Number of Sequences: 392609
Number of extensions: 134320
Number of successful extensions: 21022
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 21012
Number of HSP's gapped (non-prelim): 10
length of query: 690
length of database: 441,732,993
effective HSP length: 19
effective length of query: 671
effective length of database: 434,273,422
effective search space: 291397466162
effective search space used: 291397466162
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)