BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2405087.2.1
(737 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|CR492785.1| mth2-166H18FM1 BAC end, cultivar Jemalong A... 48 0.001
gb|AC152887.20| Medicago truncatula clone mth2-91j4, WORKIN... 48 0.001
gb|AC157648.18| Medicago truncatula clone mth2-68d9, comple... 48 0.001
gb|CB893717.1|CB893717 EST646509 HOGA Medicago truncatula c... 44 0.016
gb|AL377568.1|AL377568 MtBB32D12R1 MtBB Medicago truncatula... 42 0.065
gb|AC121232.52| Medicago truncatula clone mth2-11a18, WORKI... 42 0.065
gb|CG961642.1|CG961642 MBECV54TR mth2 Medicago truncatula g... 40 0.26
emb|CR497530.1| mth2-173F21FM1 BAC end, cultivar Jemalong A... 40 0.26
gb|AC146723.24| Medicago truncatula clone mth2-34n4, WORKIN... 40 0.26
>emb|CR492785.1| mth2-166H18FM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 742
Score = 48.1 bits (24), Expect = 0.001
Identities = 42/48 (87%)
Strand = Plus / Minus
Query: 328 tgattttgatgctttcatctgcaatagtgggagtaacatttactatcc 375
||||||||||||||| || |||| |||||||||| | ||||||||||
Sbjct: 707 tgattttgatgctttgatttgcagtagtgggagtgaactttactatcc 660
>gb|AC152887.20| Medicago truncatula clone mth2-91j4, WORKING DRAFT SEQUENCE, 2 ordered
pieces
Length = 116277
Score = 48.1 bits (24), Expect = 0.001
Identities = 42/48 (87%)
Strand = Plus / Minus
Query: 328 tgattttgatgctttcatctgcaatagtgggagtaacatttactatcc 375
||||||||||||||| || |||| |||||||||| | ||||||||||
Sbjct: 112566 tgattttgatgctttgatttgcagtagtgggagtgaactttactatcc 112519
>gb|AC157648.18| Medicago truncatula clone mth2-68d9, complete sequence
Length = 84361
Score = 48.1 bits (24), Expect = 0.001
Identities = 42/48 (87%)
Strand = Plus / Plus
Query: 328 tgattttgatgctttcatctgcaatagtgggagtaacatttactatcc 375
||||||||||||||| || |||| |||||||||| | ||||||||||
Sbjct: 61268 tgattttgatgctttgatttgcagtagtgggagtgaactttactatcc 61315
>gb|CB893717.1|CB893717 EST646509 HOGA Medicago truncatula cDNA clone HOGA-28F4, mRNA
sequence
Length = 843
Score = 44.1 bits (22), Expect = 0.016
Identities = 31/34 (91%)
Strand = Plus / Plus
Query: 328 tgattttgatgctttcatctgcaatagtgggagt 361
||||||||||||||| || |||| ||||||||||
Sbjct: 804 tgattttgatgctttgatttgcagtagtgggagt 837
>gb|AL377568.1|AL377568 MtBB32D12R1 MtBB Medicago truncatula cDNA clone MtBB32D12 T7, mRNA
sequence
Length = 477
Score = 42.1 bits (21), Expect = 0.065
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 199 gataatcagaaatgctattga 219
|||||||||||||||||||||
Sbjct: 435 gataatcagaaatgctattga 415
>gb|AC121232.52| Medicago truncatula clone mth2-11a18, WORKING DRAFT SEQUENCE, 2 ordered
pieces
Length = 106247
Score = 42.1 bits (21), Expect = 0.065
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 199 gataatcagaaatgctattga 219
|||||||||||||||||||||
Sbjct: 22733 gataatcagaaatgctattga 22753
>gb|CG961642.1|CG961642 MBECV54TR mth2 Medicago truncatula genomic clone 29I12, DNA
sequence
Length = 833
Score = 40.1 bits (20), Expect = 0.26
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 145 gaagaatatcattgttatttctgt 168
|||||||||||| |||||||||||
Sbjct: 308 gaagaatatcatagttatttctgt 285
>emb|CR497530.1| mth2-173F21FM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 385
Score = 40.1 bits (20), Expect = 0.26
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 145 gaagaatatcattgttatttctgt 168
|||||||||||| |||||||||||
Sbjct: 348 gaagaatatcatagttatttctgt 325
>gb|AC146723.24| Medicago truncatula clone mth2-34n4, WORKING DRAFT SEQUENCE, 3 ordered
pieces
Length = 121085
Score = 40.1 bits (20), Expect = 0.26
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 145 gaagaatatcattgttatttctgt 168
|||||||||||| |||||||||||
Sbjct: 79080 gaagaatatcatagttatttctgt 79103
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 241,525
Number of Sequences: 392609
Number of extensions: 241525
Number of successful extensions: 19820
Number of sequences better than 0.5: 9
Number of HSP's better than 0.5 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 19793
Number of HSP's gapped (non-prelim): 27
length of query: 737
length of database: 441,732,993
effective HSP length: 19
effective length of query: 718
effective length of database: 434,273,422
effective search space: 311808316996
effective search space used: 311808316996
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)