BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2405010.2.1
(1644 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AC144731.15| Medicago truncatula clone mth2-5g18, comple... 178 1e-042
gb|BF005098.1|BF005098 EST433596 DSLC Medicago truncatula c... 155 1e-035
gb|BF521367.1|BF521367 EST458843 DSIL Medicago truncatula c... 155 1e-035
gb|BE324735.2|BE324735 NF017F07PL1F1060 Phosphate starved l... 155 1e-035
gb|AJ845984.1|AJ845984 AJ845984 MtSC4 Medicago truncatula c... 149 9e-034
gb|BI271920.1|BI271920 NF016B07FL1F1060 Developing flower M... 147 3e-033
gb|AJ846173.1|AJ846173 AJ846173 MtSC4 Medicago truncatula c... 147 3e-033
emb|CR500702.1| mth2-178K7FM1 BAC end, cultivar Jemalong A1... 143 5e-032
gb|BG457821.1|BG457821 NF034G07PL1F1053 Phosphate starved l... 141 2e-031
gb|BI310937.1|BI310937 EST5312687 GESD Medicago truncatula ... 139 8e-031
gb|AJ845980.1|AJ845980 AJ845980 MtSC4 Medicago truncatula c... 135 1e-029
gb|CX526584.1|CX526584 s13dNF36D11AT094_513680 Aphid-Infect... 127 3e-027
gb|CX517231.1|CX517231 s13dNF06D03VI030_399481 Virus-Infect... 123 5e-026
gb|BE322328.2|BE322328 NF022F03IN1F1028 Insect herbivory Me... 121 2e-025
gb|BI266212.1|BI266212 NF088E11IN1F1087 Insect herbivory Me... 121 2e-025
gb|BE941214.1|BE941214 EST420793 MGHG Medicago truncatula c... 119 8e-025
gb|CX541514.1|CX541514 s13dNF44G09GS072_466330 Germinating ... 119 8e-025
gb|BI270244.1|BI270244 NF008A04FL1F1033 Developing flower M... 117 3e-024
emb|CR499507.1| mth2-176I10RM1 BAC end, cultivar Jemalong A... 115 1e-023
gb|BI270753.1|BI270753 NF001F07FL1F1063 Developing flower M... 109 8e-022
gb|AW329346.2|AW329346 N200575e rootphos(-) Medicago trunca... 107 3e-021
gb|BG588814.1|BG588814 EST490623 MHRP- Medicago truncatula ... 100 7e-019
gb|AJ846171.1|AJ846171 AJ846171 MtSC4 Medicago truncatula c... 100 7e-019
gb|CX541721.1|CX541721 s13dNF91F09GS079_466744 Germinating ... 100 7e-019
gb|BI311527.1|BI311527 EST5313277 GESD Medicago truncatula ... 94 4e-017
gb|BM780218.1|BM780218 EST590794 KV2 Medicago truncatula cD... 94 4e-017
gb|BE203279.1|BE203279 EST403301 KV1 Medicago truncatula cD... 92 2e-016
gb|AW560933.1|AW560933 EST315981 DSIR Medicago truncatula c... 88 3e-015
gb|CB894212.1|CB894212 EST647004 HOGA Medicago truncatula c... 88 3e-015
gb|BQ122467.1|BQ122467 EST608043 GLSD Medicago truncatula c... 86 1e-014
gb|BG455787.1|BG455787 NF070B03PL1F1027 Phosphate starved l... 82 2e-013
gb|BG644894.1|BG644894 EST506513 KV3 Medicago truncatula cD... 82 2e-013
gb|AW776813.1|AW776813 EST335878 DSIL Medicago truncatula c... 80 7e-013
gb|BE322743.2|BE322743 NF047D11IN1F1091 Insect herbivory Me... 80 7e-013
gb|BG647217.1|BG647217 EST508836 HOGA Medicago truncatula c... 80 7e-013
gb|BQ079357.1|BQ079357 MtNo1193 Medicago truncatula R108 Me... 80 7e-013
gb|CB891065.1|CB891065 EST648034 KV3 Medicago truncatula cD... 78 3e-012
gb|AC144515.14| Medicago truncatula clone mth2-5j8, complet... 78 3e-012
gb|CG971326.1|CG971326 MBEFK53TF mth2 Medicago truncatula g... 74 4e-011
emb|CR497236.1| mth2-173K15FM1 BAC end, cultivar Jemalong A... 74 4e-011
gb|BQ122194.1|BQ122194 EST607770 GLSD Medicago truncatula c... 74 4e-011
gb|BE999198.1|BE999198 EST430921 GVSN Medicago truncatula c... 72 2e-010
gb|CX530539.1|CX530539 s13dNF43F03MJ028_247099 Methyl Jasmo... 72 2e-010
gb|CG937141.1|CG937141 MBEDL31TFC mth2 Medicago truncatula ... 70 7e-010
gb|BE322910.1|BE322910 NF025F04IN1F1032 Insect herbivory Me... 70 7e-010
gb|BE205188.1|BE205188 EST397864 KV0 Medicago truncatula cD... 68 3e-009
gb|AL385160.1|AL385160 MtBC26G03F1 MtBC Medicago truncatula... 68 3e-009
gb|BE941504.1|BE941504 EST421083 MGHG Medicago truncatula c... 68 3e-009
gb|BF641008.1|BF641008 NF031H06IN1F1059 Insect herbivory Me... 68 3e-009
gb|BE315720.2|BE315720 NF025G10LF1F1072 Developing leaf Med... 68 3e-009
gb|BQ165336.1|BQ165336 EST611205 KVKC Medicago truncatula c... 68 3e-009
gb|AJ501450.1|AJ501450 AJ501450 MTAMP Medicago truncatula c... 68 3e-009
gb|CB892417.1|CB892417 EST649386 KV3 Medicago truncatula cD... 68 3e-009
gb|CA922291.1|CA922291 EST640009 MTUS Medicago truncatula c... 68 3e-009
gb|CX521275.1|CX521275 s13dNF81A08VI055_450336 Virus-Infect... 68 3e-009
gb|CG919934.1|CG919934 MBEJC72TF mth2 Medicago truncatula g... 66 1e-008
gb|BQ153168.1|BQ153168 NF031D02IR1F1016 Irradiated Medicago... 66 1e-008
gb|CG936520.1|CG936520 MBEFM57TF mth2 Medicago truncatula g... 64 4e-008
gb|CG953189.1|CG953189 MBEDW35TFC mth2 Medicago truncatula ... 64 4e-008
gb|AA660742.1|AA660742 00634 MtRHE Medicago truncatula cDNA... 62 2e-007
gb|AW225606.1|AW225606 T210057e KV0 Medicago truncatula cDN... 62 2e-007
gb|AW256758.1|AW256758 EST304895 KV2 Medicago truncatula cD... 62 2e-007
gb|AW560946.1|AW560946 EST315994 DSIR Medicago truncatula c... 62 2e-007
gb|AW684902.1|AW684902 NF022G12NR1F1000 Nodulated root Medi... 62 2e-007
gb|AW685664.1|AW685664 NF033C11NR1F1000 Nodulated root Medi... 62 2e-007
gb|AW690199.1|AW690199 NF029H04ST1F1000 Developing stem Med... 62 2e-007
gb|AW690582.1|AW690582 NF031D09ST1F1000 Developing stem Med... 62 2e-007
gb|AW694065.1|AW694065 NF072A08ST1F1056 Developing stem Med... 62 2e-007
gb|AW696033.1|AW696033 NF101B09ST1F1076 Developing stem Med... 62 2e-007
gb|AW696764.1|AW696764 NF108G02ST1F1018 Developing stem Med... 62 2e-007
gb|AW774306.1|AW774306 EST333457 KV3 Medicago truncatula cD... 62 2e-007
gb|BE322403.1|BE322403 NF020F10IN1F1080 Insect herbivory Me... 62 2e-007
gb|BE325827.1|BE325827 NF020E06ST1F1040 Developing stem Med... 62 2e-007
gb|BE202720.1|BE202720 EST402742 KV1 Medicago truncatula cD... 62 2e-007
gb|AL367944.1|AL367944 MtBA21C07F1 MtBA Medicago truncatula... 62 2e-007
gb|AL369616.1|AL369616 MtBA32C04F1 MtBA Medicago truncatula... 62 2e-007
gb|BE997864.1|BE997864 EST429587 GVSN Medicago truncatula c... 62 2e-007
gb|BE998934.1|BE998934 EST430657 GVSN Medicago truncatula c... 62 2e-007
gb|BF003258.1|BF003258 EST431686 KV1 Medicago truncatula cD... 62 2e-007
gb|BF003298.1|BF003298 EST431796 KV1 Medicago truncatula cD... 62 2e-007
gb|BF518582.1|BF518582 EST456030 DSIL Medicago truncatula c... 62 2e-007
gb|BF519548.1|BF519548 EST457012 DSIL Medicago truncatula c... 62 2e-007
gb|BF636147.1|BF636147 NF079F07DT1F1062 Drought Medicago tr... 62 2e-007
gb|BF639507.1|BF639507 NF013G04IN1F1036 Insect herbivory Me... 62 2e-007
gb|BF639659.1|BF639659 NF015H01IN1F1013 Insect herbivory Me... 62 2e-007
gb|BF639792.1|BF639792 NF019G03IN1F1024 Insect herbivory Me... 62 2e-007
gb|BF640360.1|BF640360 NF031H10IN1F1091 Insect herbivory Me... 62 2e-007
gb|BF640886.1|BF640886 NF034E06IN1F1050 Insect herbivory Me... 62 2e-007
gb|BF640995.1|BF640995 NF056G04IN1F1035 Insect herbivory Me... 62 2e-007
gb|BF641493.1|BF641493 NF066A05IN1F1036 Insect herbivory Me... 62 2e-007
gb|BF647369.1|BF647369 NF033E08EC1F1066 Elicited cell cultu... 62 2e-007
gb|AW686522.2|AW686522 NF039A05NR1F1000 Nodulated root Medi... 62 2e-007
gb|BE325669.2|BE325669 NF090C09ST1F1066 Developing stem Med... 62 2e-007
gb|AW692085.2|AW692085 NF052B02ST1F1000 Developing stem Med... 62 2e-007
gb|AW692877.2|AW692877 NF056G03ST1F1000 Developing stem Med... 62 2e-007
gb|AW694701.2|AW694701 NF079C04ST1F1033 Developing stem Med... 62 2e-007
gb|AW688346.2|AW688346 NF006C12ST1F1000 Developing stem Med... 62 2e-007
gb|AW696073.2|AW696073 NF101F05ST1F1046 Developing stem Med... 62 2e-007
gb|AW690098.2|AW690098 NF027H01ST1F1000 Developing stem Med... 62 2e-007
gb|AW693646.2|AW693646 NF066F12ST1F1000 Developing stem Med... 62 2e-007
gb|AW693827.2|AW693827 NF069F02ST1F1025 Developing stem Med... 62 2e-007
gb|BE315913.2|BE315913 NF028B03LF1F1025 Developing leaf Med... 62 2e-007
gb|BE321245.2|BE321245 NF023A08IN1F1053 Insect herbivory Me... 62 2e-007
gb|BE321141.2|BE321141 NF020F10IN1F1079 Insect herbivory Me... 62 2e-007
gb|BE322488.2|BE322488 NF008C05IN1F1035 Insect herbivory Me... 62 2e-007
gb|BE322357.2|BE322357 NF023A08IN1F1054 Insect herbivory Me... 62 2e-007
gb|BE321840.2|BE321840 NF045C08IN1F1055 Insect herbivory Me... 62 2e-007
gb|BE248392.2|BE248392 NF004E05DT1F1035 Drought Medicago tr... 62 2e-007
gb|BG449154.1|BG449154 NF033F08IN1F1073 Insect herbivory Me... 62 2e-007
gb|BG449393.1|BG449393 NF052B12IN1F1095 Insect herbivory Me... 62 2e-007
gb|BG449425.1|BG449425 NF052H08IN1F1074 Insect herbivory Me... 62 2e-007
gb|BG449487.1|BG449487 NF052A04IN1F1023 Insect herbivory Me... 62 2e-007
gb|BG449533.1|BG449533 NF052D01IN1F1012 Insect herbivory Me... 62 2e-007
gb|BG449832.1|BG449832 NF053D12IN1F1095 Insect herbivory Me... 62 2e-007
gb|BG450479.1|BG450479 NF019E02DT1F1019 Drought Medicago tr... 62 2e-007
gb|BI265128.1|BI265128 NF078H04IN1F1044 Insect herbivory Me... 62 2e-007
gb|BI265970.1|BI265970 NF120G01IN1F1008 Insect herbivory Me... 62 2e-007
gb|BI266272.1|BI266272 NF090A12IN1F1097 Insect herbivory Me... 62 2e-007
gb|BI266290.1|BI266290 NF081H07IN1F1064 Insect herbivory Me... 62 2e-007
gb|BI266764.1|BI266764 NF085D05IN1F1046 Insect herbivory Me... 62 2e-007
gb|BI267484.1|BI267484 NF106B11IN1F1093 Insect herbivory Me... 62 2e-007
gb|BI267652.1|BI267652 NF111C04IN1F1034 Insect herbivory Me... 62 2e-007
gb|BI267708.1|BI267708 NF113H07IN1F1064 Insect herbivory Me... 62 2e-007
gb|BI268142.1|BI268142 NF116H06IN1F1060 Insect herbivory Me... 62 2e-007
gb|BI268336.1|BI268336 NF117C09IN1F1070 Insect herbivory Me... 62 2e-007
gb|BI309851.1|BI309851 EST5311601 GESD Medicago truncatula ... 62 2e-007
gb|BQ139714.1|BQ139714 NF023F01PH1F1014 Phoma-infected Medi... 62 2e-007
gb|BQ140655.1|BQ140655 NF038D07PH1F1062 Phoma-infected Medi... 62 2e-007
gb|BQ255354.1|BQ255354 MTNAH32TKM KVKC Medicago truncatula ... 62 2e-007
gb|CA917995.1|CA917995 EST642142 GPOD Medicago truncatula c... 62 2e-007
gb|CB891764.1|CB891764 EST648733 KV3 Medicago truncatula cD... 62 2e-007
gb|AJ845551.1|AJ845551 AJ845551 MtSNF Medicago truncatula c... 62 2e-007
gb|CX523803.1|CX523803 s13dNF05C04AT024_440004 Aphid-Infect... 62 2e-007
gb|CX524352.1|CX524352 s13dNF14G07AT054_448048 Aphid-Infect... 62 2e-007
gb|CX524799.1|CX524799 s13dNF11B11AT093_478232 Aphid-Infect... 62 2e-007
gb|CX524887.1|CX524887 s13dNF13B07AT061_478408 Aphid-Infect... 62 2e-007
gb|CX525193.1|CX525193 s13dNF20E08AT067_479020 Aphid-Infect... 62 2e-007
gb|CX525747.1|CX525747 s13dNF30E05AT039_509238 Aphid-Infect... 62 2e-007
gb|CX525774.1|CX525774 s13dNF30G08AT068_509292 Aphid-Infect... 62 2e-007
gb|CX525846.1|CX525846 s13dNF31E09AT071_509436 Aphid-Infect... 62 2e-007
gb|CX526078.1|CX526078 s13dNF28A05AT037_509900 Aphid-Infect... 62 2e-007
gb|CX526550.1|CX526550 s13dNF36B01AT009_513612 Aphid-Infect... 62 2e-007
gb|CX526558.1|CX526558 s13dNF36B09AT077_513628 Aphid-Infect... 62 2e-007
gb|CX527042.1|CX527042 s13dNF39D02AT026_514596 Aphid-Infect... 62 2e-007
gb|CX527752.1|CX527752 s13dNF47A01AT001_516016 Aphid-Infect... 62 2e-007
gb|CX527988.1|CX527988 s13dNF50E06AT051_516488 Aphid-Infect... 62 2e-007
gb|CX528061.1|CX528061 s13dNF51C11AT086_516634 Aphid-Infect... 62 2e-007
gb|CX528462.1|CX528462 s13dNF56F08AT075_517436 Aphid-Infect... 62 2e-007
gb|CX528539.1|CX528539 s13dNF55E02AT019_517590 Aphid-Infect... 62 2e-007
gb|CX532132.1|CX532132 s13dNF64E02MJ007_270565 Methyl Jasmo... 62 2e-007
gb|DW017870.1|DW017870 EST1226831 MTY Medicago truncatula c... 62 2e-007
gb|BE321617.2|BE321617 NF022F03IN1F1027 Insect herbivory Me... 60 6e-007
gb|AL370844.1|AL370844 MtBA40C07F1 MtBA Medicago truncatula... 58 2e-006
gb|BF640307.1|BF640307 NF027A02IN1F1008 Insect herbivory Me... 58 2e-006
gb|BF644190.1|BF644190 NF060F11EC1F1095 Elicited cell cultu... 58 2e-006
gb|BF647897.1|BF647897 NF038C05EC1F1037 Elicited cell cultu... 58 2e-006
gb|BE204517.1|BE204517 EST397193 KV0 Medicago truncatula cD... 54 4e-005
gb|AL369567.1|AL369567 MtBA31H12R1 MtBA Medicago truncatula... 50 6e-004
gb|AC144730.24| Medicago truncatula clone mth2-5j23, WORKIN... 50 6e-004
gb|CG925652.1|CG925652 MBEAE21TR mth2 Medicago truncatula g... 48 0.002
gb|BF005447.1|BF005447 EST433945 DSLC Medicago truncatula c... 48 0.002
gb|BQ141708.1|BQ141708 NF014A01IN1F1003 Insect herbivory Me... 44 0.037
gb|BV165756.1| TGDH-1 PCR fragment of the molecular marker,... 44 0.037
gb|BV165757.1| TGDH-2 PCR fragment of the molecular marker,... 44 0.037
>gb|AC144731.15| Medicago truncatula clone mth2-5g18, complete sequence
Length = 115175
Score = 178 bits (90), Expect = 1e-042
Identities = 324/402 (80%)
Strand = Plus / Minus
Query: 587 ctccctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcg 646
||||| ||| ||||| || |||||||| || || ||||| || || | |||||| ||||
Sbjct: 13239 ctcccgaactgtaacctcgttgttcgggttacccacattaaatatcttgccattagctct 13180
Query: 647 agcaggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggt 706
|||||| ||||||||||||| || || || || |||||||| ||||| || | ||| ||
Sbjct: 13179 agcagggttttcaatcatcaacaacactgcctcaatagcatctttgatataaagaaaagt 13120
Query: 707 tctctgagactgacccccatcaacaagcttcaagggctctctccggagcagattgttact 766
|||||||||| ||| ||||| ||||||||||| ||||||| || || |||||||| ||
Sbjct: 13119 cctctgagactcaccaccatctacaagcttcaacggctctccacgaagaagattgttgct 13060
Query: 767 gaagcaagccaaaacccgaggcacaccctcgctaggaccatcgacaccaggaatgaaatc 826
||||||||| | ||||| ||| || ||||| || |||||||| |||||||||||||||||
Sbjct: 13059 gaagcaagcaagaaccctaggaactccctcacttggaccatcaacaccaggaatgaaatc 13000
Query: 827 catccttggcccaatccaattaaaaggtctcacgattgtgaattcaaggccattttctgc 886
||| || || ||||||||||||||||| ||||| ||||| || || | || ||||| |
Sbjct: 12999 cattctcggtccaatccaattaaaaggcctcacaattgtaaactccaaccccttttcatc 12940
Query: 887 accttcagcaaatacaagcctctcaataagttgcttcgcgcaagcataggaccatctttg 946
||||||| || | | | ||| ||||| | |||||||| || ||||| |||||||||||
Sbjct: 12939 accttcaccataaatcaacctttcaatcaactgcttcgcacatgcatacgaccatctttg 12880
Query: 947 tttcacgattggaccaaaaatacagggcgactcatcttcttt 988
|| |||| ||||| ||||| || || || |||||||||||
Sbjct: 12879 cttttcgatcggaccgaaaatgcacggagattcatcttcttt 12838
Score = 54.0 bits (27), Expect = 4e-005
Identities = 69/83 (83%)
Strand = Plus / Minus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
||||| || ||||| || |||||||||||||| || ||||| || || || ||||||||
Sbjct: 13412 gtcttcggattccatccaagctgcttgttgatgatggtcatatcaggaattctcttgtca 13353
Query: 474 ctatcatcgtatccttcgccgta 496
|||||||| ||||| || |||||
Sbjct: 13352 ctatcatcatatccctcaccgta 13330
Score = 54.0 bits (27), Expect = 4e-005
Identities = 105/131 (80%)
Strand = Plus / Minus
Query: 1116 accactgggagtgcatcgatgaagttgctgtagatggtgtcaagggggcgagtgttgtag 1175
|||||||| | |||||| | |||||| ||||| || |||||||| || |||||||||||
Sbjct: 12710 accactggaattgcatcaacgaagttactgtaaatcgtgtcaagaggacgagtgttgtaa 12651
Query: 1176 tccgccggcgtgcagatagccgccaggttgatggtcagatcggccatcttgatgagcccc 1235
|| || || |||||||| || || ||||| ||| ||||| || || |||||||| ||
Sbjct: 12650 tcggcaggtgtgcagattgcagcaaggtttatgacaagatcagcaattttgatgagacct 12591
Query: 1236 tcgagcctgga 1246
||||| |||||
Sbjct: 12590 tcgagtctgga 12580
Score = 50.1 bits (25), Expect = 6e-004
Identities = 49/57 (85%)
Strand = Plus / Minus
Query: 1373 catgagcttctcgcagaggtgggagccgatgaagccgccggcgccaatcatgcagat 1429
|||||||||||| |||||||| || |||||||| || || ||||| || ||||||||
Sbjct: 12453 catgagcttctcacagaggtgagaaccgatgaaacctccagcgccgataatgcagat 12397
>gb|BF005098.1|BF005098 EST433596 DSLC Medicago truncatula cDNA clone pDSLC-31A10, mRNA
sequence
Length = 642
Score = 155 bits (78), Expect = 1e-035
Identities = 321/402 (79%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 430 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 371
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 370 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 311
Query: 710 ctgagactgacccccatcaacaagcttcaagggctctctccggagcagattgttactgaa 769
||| || | ||| ||||| |||||||| | |||||||| | || ||||| || |||||
Sbjct: 310 ctgggattcaccaccatccacaagcttgaggggctctcctctaagaagattattgctgaa 251
Query: 770 gcaagccaaaacccgaggcacaccctcgctaggaccatcgacaccaggaatgaaatccat 829
||| || | ||| || || |||||||| || || || || | ||| |||||||| |||||
Sbjct: 250 gcatgcaagaacacggggaacaccctcacttggtccgtcaataccgggaatgaagtccat 191
Query: 830 ccttggcccaatccaattaaaaggtctcacgattgtgaattcaaggccattttctgcacc 889
|| || || ||||||||||| || ||||| |||||||| || | ||| ||||| |||||
Sbjct: 190 tctaggtccgatccaattaaagggcctcacaattgtgaactccaagccgttttcagcacc 131
Query: 890 ttcagcaaatacaagcctctcaataagttgcttcgcgcaagcataggaccatctttgttt 949
|||||| | || ||||||||||| | ||||| || || ||||| |||||||| || ||
Sbjct: 130 ctcagcataaaccagcctctcaatcaactgctttgcacatgcatatgaccatctctgctt 71
Query: 950 cacgattggaccaaaaatacagggcgactcatcttctttaag 991
|||||| ||| ||||| || || ||| |||||||||||||
Sbjct: 70 ttcgattgaaccgaaaatgcatggagacacatcttctttaag 29
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 606 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 547
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 546 ctatcatcatatcc 533
>gb|BF521367.1|BF521367 EST458843 DSIL Medicago truncatula cDNA clone pDSIL-43M23, mRNA
sequence
Length = 718
Score = 155 bits (78), Expect = 1e-035
Identities = 321/402 (79%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 607 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 548
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 547 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 488
Query: 710 ctgagactgacccccatcaacaagcttcaagggctctctccggagcagattgttactgaa 769
||| || | ||| ||||| |||||||| | |||||||| | || ||||| || |||||
Sbjct: 487 ctgggattcaccaccatccacaagcttgaggggctctcctctaagaagattattgctgaa 428
Query: 770 gcaagccaaaacccgaggcacaccctcgctaggaccatcgacaccaggaatgaaatccat 829
||| || | ||| || || |||||||| || || || || | ||| |||||||| |||||
Sbjct: 427 gcatgcaagaacacggggaacaccctcacttggtccgtcaataccgggaatgaagtccat 368
Query: 830 ccttggcccaatccaattaaaaggtctcacgattgtgaattcaaggccattttctgcacc 889
|| || || ||||||||||| || ||||| |||||||| || | ||| ||||| |||||
Sbjct: 367 tctaggtccgatccaattaaagggcctcacaattgtgaactccaagccgttttcagcacc 308
Query: 890 ttcagcaaatacaagcctctcaataagttgcttcgcgcaagcataggaccatctttgttt 949
|||||| | || ||||||||||| | ||||| || || ||||| |||||||| || ||
Sbjct: 307 ctcagcataaaccagcctctcaatcaactgctttgcacatgcatatgaccatctctgctt 248
Query: 950 cacgattggaccaaaaatacagggcgactcatcttctttaag 991
|||||| ||| ||||| || || ||| |||||||||||||
Sbjct: 247 ttcgattgaaccgaaaatgcatggagacacatcttctttaag 206
>gb|BE324735.2|BE324735 NF017F07PL1F1060 Phosphate starved leaf Medicago truncatula cDNA
clone NF017F07PL 5', mRNA sequence
Length = 505
Score = 155 bits (78), Expect = 1e-035
Identities = 321/402 (79%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 430 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 371
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 370 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 311
Query: 710 ctgagactgacccccatcaacaagcttcaagggctctctccggagcagattgttactgaa 769
||| || | ||| ||||| |||||||| | |||||||| | || ||||| || |||||
Sbjct: 310 ctgggattcaccaccatccacaagcttgaggggctctcctctaagaagattattgctgaa 251
Query: 770 gcaagccaaaacccgaggcacaccctcgctaggaccatcgacaccaggaatgaaatccat 829
||| || | ||| || || |||||||| || || || || | ||| |||||||| |||||
Sbjct: 250 gcatgcaagaacacggggaacaccctcacttggtccgtcaataccgggaatgaagtccat 191
Query: 830 ccttggcccaatccaattaaaaggtctcacgattgtgaattcaaggccattttctgcacc 889
|| || || ||||||||||| || ||||| |||||||| || | ||| ||||| |||||
Sbjct: 190 tctaggtccgatccaattaaagggcctcacaattgtgaactccaagccgttttcagcacc 131
Query: 890 ttcagcaaatacaagcctctcaataagttgcttcgcgcaagcataggaccatctttgttt 949
|||||| | || ||||||||||| | ||||| || || ||||| |||||||| || ||
Sbjct: 130 ctcagcataaaccagcctctcaatcaactgctttgcacatgcatatgaccatctctgctt 71
Query: 950 cacgattggaccaaaaatacagggcgactcatcttctttaag 991
|||||| ||| ||||| || || ||| |||||||||||||
Sbjct: 70 ttcgattgaaccgaaaatgcatggagacacatcttctttaag 29
>gb|AJ845984.1|AJ845984 AJ845984 MtSC4 Medicago truncatula cDNA clone MtC401B19N2, mRNA
sequence
Length = 780
Score = 149 bits (75), Expect = 9e-034
Identities = 320/402 (79%)
Strand = Plus / Plus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 320 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 379
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 380 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 439
Query: 710 ctgagactgacccccatcaacaagcttcaagggctctctccggagcagattgttactgaa 769
||| || | ||| ||||| |||||||| | |||||||| | || ||||| || |||||
Sbjct: 440 ctgggattcaccaccatccacaagcttgaggggctctcctctaagaagattattgctgaa 499
Query: 770 gcaagccaaaacccgaggcacaccctcgctaggaccatcgacaccaggaatgaaatccat 829
||| || | ||| || || |||||||| || || || || | ||| |||||||| |||||
Sbjct: 500 gcatgcaagaacacggggaacaccctcacttggtccgtcaataccgggaatgaagtccat 559
Query: 830 ccttggcccaatccaattaaaaggtctcacgattgtgaattcaaggccattttctgcacc 889
|| || || ||||||||||| || ||||| |||||||| || | ||| ||||| |||||
Sbjct: 560 tctaggtccgatccaattaaagggcctcacaattgtgaactccaagccgttttcagcacc 619
Query: 890 ttcagcaaatacaagcctctcaataagttgcttcgcgcaagcataggaccatctttgttt 949
|||||| | || ||||||||||| | ||||| || || ||||| |||||||| || ||
Sbjct: 620 ctcagcataaaccagcctctcaatcaactgctttgcacatgcatatgaccatctctgctt 679
Query: 950 cacgattggaccaaaaatacagggcgactcatcttctttaag 991
|||||| ||| || || || || ||| |||||||||||||
Sbjct: 680 ttcgattgaaccgaanatgcatggagacacatcttctttaag 721
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Plus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 144 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 203
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 204 ctatcatcatatcc 217
>gb|BI271920.1|BI271920 NF016B07FL1F1060 Developing flower Medicago truncatula cDNA clone
NF016B07FL 5', mRNA sequence
Length = 678
Score = 147 bits (74), Expect = 3e-033
Identities = 320/402 (79%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||| | |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 589 cctaactgtaccctcattgtttgggttacccacattaaaaatatggccattggctctggc 530
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 529 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 470
Query: 710 ctgagactgacccccatcaacaagcttcaagggctctctccggagcagattgttactgaa 769
||| || | ||| ||||| |||||||| | |||||||| | || ||||| || |||||
Sbjct: 469 ctgggattcaccaccatccacaagcttgaggggctctcctctaagaagattattgctgaa 410
Query: 770 gcaagccaaaacccgaggcacaccctcgctaggaccatcgacaccaggaatgaaatccat 829
||| || | ||| || || |||||||| || || || || | ||| |||||||| |||||
Sbjct: 409 gcatgcaagaacacggggaacaccctcacttggtccgtcaataccgggaatgaagtccat 350
Query: 830 ccttggcccaatccaattaaaaggtctcacgattgtgaattcaaggccattttctgcacc 889
|| || || ||||||||||| || ||||| |||||||| || | ||| ||||| |||||
Sbjct: 349 tctaggtccgatccaattaaagggcctcacaattgtgaactccaagccgttttcagcacc 290
Query: 890 ttcagcaaatacaagcctctcaataagttgcttcgcgcaagcataggaccatctttgttt 949
|||||| | || ||||||||||| | ||||| || || ||||| |||||||| || ||
Sbjct: 289 ctcagcataaaccagcctctcaatcaactgctttgcacatgcatatgaccatctctgctt 230
Query: 950 cacgattggaccaaaaatacagggcgactcatcttctttaag 991
|||||| ||| ||||| || || ||| |||||||||||||
Sbjct: 229 ttcgattgaaccgaaaatgcatggagacacatcttctttaag 188
>gb|AJ846173.1|AJ846173 AJ846173 MtSC4 Medicago truncatula cDNA clone MtC408I19N1, mRNA
sequence
Length = 760
Score = 147 bits (74), Expect = 3e-033
Identities = 320/402 (79%)
Strand = Plus / Plus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 298 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 357
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 358 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 417
Query: 710 ctgagactgacccccatcaacaagcttcaagggctctctccggagcagattgttactgaa 769
||| || | ||| ||||| |||||||| | |||||||| | || ||||| || |||||
Sbjct: 418 ctgggattcaccaccatccacaagcttgaggggctctcctctaagaagattattgctgaa 477
Query: 770 gcaagccaaaacccgaggcacaccctcgctaggaccatcgacaccaggaatgaaatccat 829
||| || | ||| || || |||||||| || || || || | ||| |||||||| |||||
Sbjct: 478 gcatgcaagaacacggggaacaccctcacttggtccgtcaataccgggaatgaagtccat 537
Query: 830 ccttggcccaatccaattaaaaggtctcacgattgtgaattcaaggccattttctgcacc 889
|| || || ||||||||||| || ||||| |||||||| || | ||| ||||| |||||
Sbjct: 538 tctaggtccgatccaattaaagggcctcacaattgtgaactccaagccgttttcagcacc 597
Query: 890 ttcagcaaatacaagcctctcaataagttgcttcgcgcaagcataggaccatctttgttt 949
|||||| | || | ||||||||| | ||||| || || ||||| |||||||| || ||
Sbjct: 598 ctcagcataaaccaacctctcaatcaactgctttgcacatgcatatgaccatctctgctt 657
Query: 950 cacgattggaccaaaaatacagggcgactcatcttctttaag 991
|||||| ||| ||||| || || ||| |||||||||||||
Sbjct: 658 ttcgattgaaccgaaaatgcatggagacacatcttctttaag 699
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Plus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 122 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 181
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 182 ctatcatcatatcc 195
>emb|CR500702.1| mth2-178K7FM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 648
Score = 143 bits (72), Expect = 5e-032
Identities = 210/256 (82%)
Strand = Plus / Plus
Query: 733 gcttcaagggctctctccggagcagattgttactgaagcaagccaaaacccgaggcacac 792
||||||| ||||||| || || |||||||| ||||||||||| | ||||| ||| || |
Sbjct: 2 gcttcaacggctctcctcgaagaagattgttgctgaagcaagcaagaaccctaggaactc 61
Query: 793 cctcgctaggaccatcgacaccaggaatgaaatccatccttggcccaatccaattaaaag 852
|||| || |||||||| |||| ||||||||||||||| || || ||||||||||||||||
Sbjct: 62 cctcacttggaccatcaacactaggaatgaaatccattctcggtccaatccaattaaaag 121
Query: 853 gtctcacgattgtgaattcaaggccattttctgcaccttcagcaaatacaagcctctcaa 912
||||||| ||||| ||||| | |||||||| ||||||| || | | | ||||||||
Sbjct: 122 gtctcacaattgtaaattccaacccattttcatcaccttctccataaatcaacctctcaa 181
Query: 913 taagttgcttcgcgcaagcataggaccatctttgtttcacgattggaccaaaaatacagg 972
| | |||||| || || ||||| ||||||||||| || |||| ||||||||||| || |
Sbjct: 182 tcaattgcttagcacatgcatatgaccatctttgcttttcgatcggaccaaaaatgcacg 241
Query: 973 gcgactcatcttcttt 988
| || |||||||||||
Sbjct: 242 gagattcatcttcttt 257
Score = 58.0 bits (29), Expect = 2e-006
Identities = 68/81 (83%)
Strand = Plus / Plus
Query: 1128 gcatcgatgaagttgctgtagatggtgtcaagggggcgagtgttgtagtccgccggcgtg 1187
||||| |||||||| ||||| || |||||||| || ||||||||||| || || || |||
Sbjct: 397 gcatcaatgaagttactgtaaatcgtgtcaagaggacgagtgttgtaatcagcaggagtg 456
Query: 1188 cagatagccgccaggttgatg 1208
||||| || || |||||||||
Sbjct: 457 cagattgcagcaaggttgatg 477
>gb|BG457821.1|BG457821 NF034G07PL1F1053 Phosphate starved leaf Medicago truncatula cDNA
clone NF034G07PL 5', mRNA sequence
Length = 618
Score = 141 bits (71), Expect = 2e-031
Identities = 321/403 (79%), Gaps = 1/403 (0%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 431 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 372
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 371 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 312
Query: 710 ctgagactgacccccatcaacaagcttcaagggctctctccggagcagattgttactgaa 769
||| || | ||| ||||| |||||||| | |||||||| | || ||||| || |||||
Sbjct: 311 ctgggattcaccaccatccacaagcttgaggggctctcctctaagaagattattgctgaa 252
Query: 770 gcaagccaaaacccgaggcacaccctcgctaggaccatcgacaccaggaatgaaatccat 829
||| || | ||| || || |||||||| || || || || | ||| |||||||| |||||
Sbjct: 251 gcatgcaagaacacggggaacaccctcacttggtccgtcaataccgggaatgaagtccat 192
Query: 830 ccttggcccaatccaattaaaaggtctcacgattgtgaattcaaggccattttctgcacc 889
|| || || ||||||||||| || ||||| |||||||| || | ||| ||||| |||||
Sbjct: 191 tctaggtccgatccaattaaagggcctcacaattgtgaactccaagccgttttcagcacc 132
Query: 890 ttca-gcaaatacaagcctctcaataagttgcttcgcgcaagcataggaccatctttgtt 948
||| ||| | || ||||||||||| | ||||| || || ||||| |||||||| || |
Sbjct: 131 ctcangcataaaccagcctctcaatcaactgctttgcacatgcatatgaccatctctgct 72
Query: 949 tcacgattggaccaaaaatacagggcgactcatcttctttaag 991
| |||||| ||| ||||| || || ||| |||||||||||||
Sbjct: 71 tttcgattgaaccgaaaatgcatggagacacatcttctttaag 29
>gb|BI310937.1|BI310937 EST5312687 GESD Medicago truncatula cDNA clone pGESD9B3 5' end,
mRNA sequence
Length = 750
Score = 139 bits (70), Expect = 8e-031
Identities = 283/354 (79%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 360 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 301
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 300 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 241
Query: 710 ctgagactgacccccatcaacaagcttcaagggctctctccggagcagattgttactgaa 769
||| || | ||| ||||| |||||||| | |||||||| | || ||||| || |||||
Sbjct: 240 ctgggattcaccaccatccacaagcttgaggggctctcctctaagaagattattgctgaa 181
Query: 770 gcaagccaaaacccgaggcacaccctcgctaggaccatcgacaccaggaatgaaatccat 829
||| || | ||| || || |||||||| || || || || | ||| |||||||| |||||
Sbjct: 180 gcatgcaagaacacggggaacaccctcacttggtccgtcaataccgggaatgaagtccat 121
Query: 830 ccttggcccaatccaattaaaaggtctcacgattgtgaattcaaggccattttctgcacc 889
|| || || ||||||||||| || ||||| |||||||| || | ||| ||||| |||||
Sbjct: 120 tctaggtccgatccaattaaagggcctcacaattgtgaactccaagccgttttcagcacc 61
Query: 890 ttcagcaaatacaagcctctcaataagttgcttcgcgcaagcataggaccatct 943
|||||| | || ||||||||||| | ||||| || || ||||| ||||||||
Sbjct: 60 ctcagcataaaccagcctctcaatcaactgctttgcacatgcatatgaccatct 7
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 536 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 477
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 476 ctatcatcatatcc 463
>gb|AJ845980.1|AJ845980 AJ845980 MtSC4 Medicago truncatula cDNA clone MtC401A11N2, mRNA
sequence
Length = 654
Score = 135 bits (68), Expect = 1e-029
Identities = 260/324 (80%)
Strand = Plus / Plus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 310 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 369
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 370 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 429
Query: 710 ctgagactgacccccatcaacaagcttcaagggctctctccggagcagattgttactgaa 769
||| || | ||| ||||| |||||||| | |||||||| | || ||||| || |||||
Sbjct: 430 ctgggattcaccaccatccacaagcttgaggggctctcctctaagaagattattgctgaa 489
Query: 770 gcaagccaaaacccgaggcacaccctcgctaggaccatcgacaccaggaatgaaatccat 829
||| || | ||| || || |||||||| || || || || | ||| |||||||| |||||
Sbjct: 490 gcatgcaagaacacggggaacaccctcacttggtccgtcaataccgggaatgaagtccat 549
Query: 830 ccttggcccaatccaattaaaaggtctcacgattgtgaattcaaggccattttctgcacc 889
|| || || ||||||||||| || ||||| |||||||| || | ||| ||||| |||||
Sbjct: 550 tctaggtccgatccaattaaagggcctcacaattgtgaactccaagccgttttcagcacc 609
Query: 890 ttcagcaaatacaagcctctcaat 913
|||||| | || |||||||||||
Sbjct: 610 ctcagcataaaccagcctctcaat 633
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Plus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 134 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 193
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 194 ctatcatcatatcc 207
>gb|CX526584.1|CX526584 s13dNF36D11AT094_513680 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 604
Score = 127 bits (64), Expect = 3e-027
Identities = 274/344 (79%)
Strand = Plus / Minus
Query: 648 gcaggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggtt 707
||||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||
Sbjct: 601 gcagggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgtt 542
Query: 708 ctctgagactgacccccatcaacaagcttcaagggctctctccggagcagattgttactg 767
||||| || | ||| ||||| |||||||| | |||||||| | || ||||| || |||
Sbjct: 541 ctctgggattcaccaccatccacaagcttgaggggctctcctctaagaagattattgctg 482
Query: 768 aagcaagccaaaacccgaggcacaccctcgctaggaccatcgacaccaggaatgaaatcc 827
||||| || | ||| || || |||||||| || || || || | ||| |||||||| |||
Sbjct: 481 aagcatgcaagaacacggggaacaccctcacttggtccgtcaataccgggaatgaagtcc 422
Query: 828 atccttggcccaatccaattaaaaggtctcacgattgtgaattcaaggccattttctgca 887
|| || || || ||||||||||| || ||||| |||||||| || | ||| ||||| |||
Sbjct: 421 attctaggtccgatccaattaaagggcctcacaattgtgaactccaagccgttttcagca 362
Query: 888 ccttcagcaaatacaagcctctcaataagttgcttcgcgcaagcataggaccatctttgt 947
|| |||||| | || ||||||||||| | ||||| || || ||||| |||||||| ||
Sbjct: 361 ccctcagcataaaccagcctctcaatcaactgctttgcacatgcatatgaccatctctgc 302
Query: 948 ttcacgattggaccaaaaatacagggcgactcatcttctttaag 991
|| |||||| ||| ||||| || || ||| |||||||||||||
Sbjct: 301 ttttcgattgaaccgaaaatgcatggagacacatcttctttaag 258
>gb|CX517231.1|CX517231 s13dNF06D03VI030_399481 Virus-Infected Leaves Medicago truncatula
cDNA, mRNA sequence
Length = 530
Score = 123 bits (62), Expect = 5e-026
Identities = 245/306 (80%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 315 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 256
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 255 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 196
Query: 710 ctgagactgacccccatcaacaagcttcaagggctctctccggagcagattgttactgaa 769
||| || | ||| ||||| |||||||| | |||||||| | || ||||| || |||||
Sbjct: 195 ctgggattcaccaccatccacaagcttgaggggctctcctctaagaagattattgctgaa 136
Query: 770 gcaagccaaaacccgaggcacaccctcgctaggaccatcgacaccaggaatgaaatccat 829
||| || | ||| || || |||||||| || || || || | ||| |||||||| |||||
Sbjct: 135 gcatgcaagaacacggggaacaccctcacttggtccgtcaataccgggaatgaagtccat 76
Query: 830 ccttggcccaatccaattaaaaggtctcacgattgtgaattcaaggccattttctgcacc 889
|| || || ||||||||||| || ||||| |||||||| || | ||| ||||| |||||
Sbjct: 75 tctaggtccgatccaattaaagggcctcacaattgtgaactccaagccgttttcagcacc 16
Query: 890 ttcagc 895
|||||
Sbjct: 15 ctcagc 10
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 491 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 432
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 431 ctatcatcatatcc 418
>gb|BE322328.2|BE322328 NF022F03IN1F1028 Insect herbivory Medicago truncatula cDNA clone
NF022F03IN 5', mRNA sequence
Length = 630
Score = 121 bits (61), Expect = 2e-025
Identities = 260/325 (80%), Gaps = 1/325 (0%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 342 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 283
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 282 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 223
Query: 710 ctgagactgacccccatcaacaagcttcaagggctctctccggagcagattgttactgaa 769
||| || | ||| ||||| |||||||| | |||||||| | || ||||| || |||||
Sbjct: 222 ctgggattcaccaccatccacaagcttgaggggctctcctctaagaagattattgctgaa 163
Query: 770 gcaagccaaaacccgaggcacaccctcgctaggaccatcgacaccaggaatgaaatccat 829
||| || | ||| || || |||||||| || || || || | ||| |||||||| |||||
Sbjct: 162 gcatgcaagaacacggggaacaccctcacttggtccgtcaataccgggaatgaagtccat 103
Query: 830 ccttggcccaatccaattaaaaggtctcacgattgtgaattcaaggccattttc-tgcac 888
|| || || ||||||||||| || ||||| |||||||| || | ||| ||||| ||||
Sbjct: 102 tctaggtccgatccaattaaagggcctcacaattgtgaactccaagccgttttcaggcac 43
Query: 889 cttcagcaaatacaagcctctcaat 913
| |||||| | || |||||||||||
Sbjct: 42 cctcagcataaaccagcctctcaat 18
Score = 54.0 bits (27), Expect = 4e-005
Identities = 45/51 (88%)
Strand = Plus / Minus
Query: 437 cttgttgattatagtcatgtcggggatcctcttgtcgctatcatcgtatcc 487
|||||||||||| |||||||| || || |||||||| |||||||| |||||
Sbjct: 496 cttgttgattatggtcatgtcaggaattctcttgtcactatcatcatatcc 446
>gb|BI266212.1|BI266212 NF088E11IN1F1087 Insect herbivory Medicago truncatula cDNA clone
NF088E11IN 5', mRNA sequence
Length = 644
Score = 121 bits (61), Expect = 2e-025
Identities = 244/305 (80%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 305 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 246
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 245 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 186
Query: 710 ctgagactgacccccatcaacaagcttcaagggctctctccggagcagattgttactgaa 769
||| || | ||| ||||| |||||||| | |||||||| | || ||||| || |||||
Sbjct: 185 ctgggattcaccaccatccacaagcttgaggggctctcctctaagaagattattgctgaa 126
Query: 770 gcaagccaaaacccgaggcacaccctcgctaggaccatcgacaccaggaatgaaatccat 829
||| || | ||| || || |||||||| || || || || | ||| |||||||| |||||
Sbjct: 125 gcatgcaagaacacggggaacaccctcacttggtccgtcaataccgggaatgaagtccat 66
Query: 830 ccttggcccaatccaattaaaaggtctcacgattgtgaattcaaggccattttctgcacc 889
|| || || ||||||||||| || ||||| |||||||| || | ||| ||||| |||||
Sbjct: 65 tctaggtccgatccaattaaagggcctcacaattgtgaactccaagccgttttcagcacc 6
Query: 890 ttcag 894
||||
Sbjct: 5 ctcag 1
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 481 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 422
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 421 ctatcatcatatcc 408
>gb|BE941214.1|BE941214 EST420793 MGHG Medicago truncatula cDNA clone pMGHG-3C14, mRNA
sequence
Length = 504
Score = 119 bits (60), Expect = 8e-025
Identities = 255/320 (79%)
Strand = Plus / Minus
Query: 672 acagcttcgatagcatccttgatgtagacaaaggttctctgagactgacccccatcaaca 731
|||||||| |||||||| |||||||| ||||| |||||||| || | ||| ||||| |||
Sbjct: 491 acagcttcaatagcatctttgatgtaaacaaatgttctctgggattcaccaccatccaca 432
Query: 732 agcttcaagggctctctccggagcagattgttactgaagcaagccaaaacccgaggcaca 791
||||| | |||||||| | || ||||| || |||||||| || | ||| || || |||
Sbjct: 431 agcttgaggggctctcctctaagaagattattgctgaagcatgcaagaacacggggaaca 372
Query: 792 ccctcgctaggaccatcgacaccaggaatgaaatccatccttggcccaatccaattaaaa 851
||||| || || || || | ||| |||||||| ||||| || || || |||||||||||
Sbjct: 371 ccctcacttggtccgtcaataccgggaatgaagtccattctaggtccgatccaattaaag 312
Query: 852 ggtctcacgattgtgaattcaaggccattttctgcaccttcagcaaatacaagcctctca 911
|| ||||| |||||||| || | ||| ||||| ||||| |||||| | || |||||||||
Sbjct: 311 ggcctcacaattgtgaactccaagccgttttcagcaccctcagcataaaccagcctctca 252
Query: 912 ataagttgcttcgcgcaagcataggaccatctttgtttcacgattggaccaaaaatacag 971
|| | ||||| || || ||||| |||||||| || || |||||| ||| ||||| ||
Sbjct: 251 atcaactgctttgcacatgcatatgaccatctctgcttttcgattgaaccgaaaatgcat 192
Query: 972 ggcgactcatcttctttaag 991
|| ||| |||||||||||||
Sbjct: 191 ggagacacatcttctttaag 172
>gb|CX541514.1|CX541514 s13dNF44G09GS072_466330 Germinating Seed Medicago truncatula cDNA,
mRNA sequence
Length = 546
Score = 119 bits (60), Expect = 8e-025
Identities = 240/300 (80%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 305 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 246
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 245 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 186
Query: 710 ctgagactgacccccatcaacaagcttcaagggctctctccggagcagattgttactgaa 769
||| || | ||| ||||| |||||||| | |||||||| | || ||||| || |||||
Sbjct: 185 ctgggattcaccaccatccacaagcttgaggggctctcctctaagaagattattgctgaa 126
Query: 770 gcaagccaaaacccgaggcacaccctcgctaggaccatcgacaccaggaatgaaatccat 829
||| || | ||| || || |||||||| || || || || | ||| |||||||| |||||
Sbjct: 125 gcatgcaagaacacggggaacaccctcacttggtccgtcaataccgggaatgaagtccat 66
Query: 830 ccttggcccaatccaattaaaaggtctcacgattgtgaattcaaggccattttctgcacc 889
|| || || ||||||||||| || ||||| |||||||| || | ||| ||||| |||||
Sbjct: 65 tctaggtccgatccaattaaagggcctcacaattgtgaactccaagccgttttcagcacc 6
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 481 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 422
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 421 ctatcatcatatcc 408
>gb|BI270244.1|BI270244 NF008A04FL1F1033 Developing flower Medicago truncatula cDNA clone
NF008A04FL 5', mRNA sequence
Length = 665
Score = 117 bits (59), Expect = 3e-024
Identities = 224/279 (80%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 296 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 237
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 236 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 177
Query: 710 ctgagactgacccccatcaacaagcttcaagggctctctccggagcagattgttactgaa 769
||| || | ||| ||||| |||||||| | |||||||| | || ||||| || |||||
Sbjct: 176 ctgggattcaccaccatccacaagcttgaggggctctcctctaagaagattattgctgaa 117
Query: 770 gcaagccaaaacccgaggcacaccctcgctaggaccatcgacaccaggaatgaaatccat 829
||| || | ||| || || |||||||| || || || || | ||| |||||||| |||||
Sbjct: 116 gcatgcaagaacacggggaacaccctcacttggtccgtcaataccgggaatgaagtccat 57
Query: 830 ccttggcccaatccaattaaaaggtctcacgattgtgaa 868
|| || || ||||||||||| || ||||| ||||||||
Sbjct: 56 tctaggtccgatccaattaaagggcctcacaattgtgaa 18
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 472 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 413
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 412 ctatcatcatatcc 399
>emb|CR499507.1| mth2-176I10RM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 466
Score = 115 bits (58), Expect = 1e-023
Identities = 172/210 (81%)
Strand = Plus / Plus
Query: 779 aacccgaggcacaccctcgctaggaccatcgacaccaggaatgaaatccatccttggccc 838
||||| ||| || ||||| || |||||||| |||| ||||||||||||||| || || ||
Sbjct: 30 aaccctaggaactccctcacttggaccatcaacactaggaatgaaatccattctcggtcc 89
Query: 839 aatccaattaaaaggtctcacgattgtgaattcaaggccattttctgcaccttcagcaaa 898
||||||||||||||||||||| ||||| ||||| | |||||||| ||||||| || |
Sbjct: 90 aatccaattaaaaggtctcacaattgtaaattccaacccattttcatcaccttctccata 149
Query: 899 tacaagcctctcaataagttgcttcgcgcaagcataggaccatctttgtttcacgattgg 958
| | ||||||||| | |||||| || || ||||| ||||||||||| || |||| ||
Sbjct: 150 aatcaacctctcaatcaattgcttagcacatgcatatgaccatctttgcttttcgatcgg 209
Query: 959 accaaaaatacagggcgactcatcttcttt 988
||||||||| || || || |||||||||||
Sbjct: 210 accaaaaatgcacggagattcatcttcttt 239
Score = 58.0 bits (29), Expect = 2e-006
Identities = 68/81 (83%)
Strand = Plus / Plus
Query: 1128 gcatcgatgaagttgctgtagatggtgtcaagggggcgagtgttgtagtccgccggcgtg 1187
||||| |||||||| ||||| || |||||||| || ||||||||||| || || || |||
Sbjct: 379 gcatcaatgaagttactgtaaatcgtgtcaagaggacgagtgttgtaatcagcaggagtg 438
Query: 1188 cagatagccgccaggttgatg 1208
||||| || || |||||||||
Sbjct: 439 cagattgcagcaaggttgatg 459
>gb|BI270753.1|BI270753 NF001F07FL1F1063 Developing flower Medicago truncatula cDNA clone
NF001F07FL 5', mRNA sequence
Length = 650
Score = 109 bits (55), Expect = 8e-022
Identities = 220/275 (80%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 285 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 226
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 225 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 166
Query: 710 ctgagactgacccccatcaacaagcttcaagggctctctccggagcagattgttactgaa 769
||| || | ||| ||||| |||||||| | |||||||| | || ||||| || |||||
Sbjct: 165 ctgggattcaccaccatccacaagcttgaggggctctcctctaagaagattattgctgaa 106
Query: 770 gcaagccaaaacccgaggcacaccctcgctaggaccatcgacaccaggaatgaaatccat 829
||| || | ||| || || |||||||| || || || || | ||| |||||||| |||||
Sbjct: 105 gcatgcaagaacacggggaacaccctcacttggtccgtcaataccgggaatgaagtccat 46
Query: 830 ccttggcccaatccaattaaaaggtctcacgattg 864
|| || || ||||||||||| || ||||| ||||
Sbjct: 45 tctaggtccgatccaattaaagggcctcacaattg 11
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 461 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 402
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 401 ctatcatcatatcc 388
>gb|AW329346.2|AW329346 N200575e rootphos(-) Medicago truncatula cDNA clone MHRP-19A11,
mRNA sequence
Length = 612
Score = 107 bits (54), Expect = 3e-021
Identities = 216/270 (80%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 271 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 212
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 211 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 152
Query: 710 ctgagactgacccccatcaacaagcttcaagggctctctccggagcagattgttactgaa 769
||| || | ||| ||||| |||||||| | |||||||| | || ||||| || |||||
Sbjct: 151 ctgggattcaccaccatccacaagcttgaggggctctcctctaagaagattattgctgaa 92
Query: 770 gcaagccaaaacccgaggcacaccctcgctaggaccatcgacaccaggaatgaaatccat 829
||| || | ||| || || |||||||| || || || || | ||| |||||||| |||||
Sbjct: 91 gcatgcaagaacacggggaacaccctcacttggtccgtcaataccgggaatgaagtccat 32
Query: 830 ccttggcccaatccaattaaaaggtctcac 859
|| || || ||||||||||| || |||||
Sbjct: 31 tctaggtccgatccaattaaagggcctcac 2
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 447 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 388
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 387 ctatcatcatatcc 374
>gb|BG588814.1|BG588814 EST490623 MHRP- Medicago truncatula cDNA clone pMHRP-57J3, mRNA
sequence
Length = 771
Score = 99.6 bits (50), Expect = 7e-019
Identities = 131/158 (82%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 220 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 161
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 160 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 101
Query: 710 ctgagactgacccccatcaacaagcttcaagggctctc 747
||| || | ||| ||||| |||||||| | ||||||||
Sbjct: 100 ctgggattcaccaccatccacaagcttgaggggctctc 63
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 396 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 337
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 336 ctatcatcatatcc 323
>gb|AJ846171.1|AJ846171 AJ846171 MtSC4 Medicago truncatula cDNA clone MtC408H09N2, mRNA
sequence
Length = 550
Score = 99.6 bits (50), Expect = 7e-019
Identities = 131/158 (82%)
Strand = Plus / Plus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 308 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 367
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 368 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 427
Query: 710 ctgagactgacccccatcaacaagcttcaagggctctc 747
||| || | ||| ||||| |||||||| | ||||||||
Sbjct: 428 ctgggattcaccaccatccacaagcttgaggggctctc 465
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Plus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 132 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 191
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 192 ctatcatcatatcc 205
>gb|CX541721.1|CX541721 s13dNF91F09GS079_466744 Germinating Seed Medicago truncatula cDNA,
mRNA sequence
Length = 628
Score = 99.6 bits (50), Expect = 7e-019
Identities = 131/158 (82%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 266 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 207
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 206 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 147
Query: 710 ctgagactgacccccatcaacaagcttcaagggctctc 747
||| || | ||| ||||| |||||||| | ||||||||
Sbjct: 146 ctgggattcaccaccatccacaagcttgaggggctctc 109
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 442 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 383
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 382 ctatcatcatatcc 369
>gb|BI311527.1|BI311527 EST5313277 GESD Medicago truncatula cDNA clone pGESD13I23 5' end,
mRNA sequence
Length = 790
Score = 93.7 bits (47), Expect = 4e-017
Identities = 122/147 (82%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 239 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 180
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 179 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 120
Query: 710 ctgagactgacccccatcaacaagctt 736
||| || | ||| ||||| ||||||||
Sbjct: 119 ctgggattcaccaccatccacaagctt 93
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 415 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 356
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 355 ctatcatcatatcc 342
>gb|BM780218.1|BM780218 EST590794 KV2 Medicago truncatula cDNA clone pKV2-54I18, mRNA
sequence
Length = 847
Score = 93.7 bits (47), Expect = 4e-017
Identities = 268/339 (79%), Gaps = 2/339 (0%)
Strand = Plus / Minus
Query: 655 tttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttctctgag 714
|||||||||||| | |||||||| |||||||| |||||||| ||||| |||||||| |
Sbjct: 760 tttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttctctggg 701
Query: 715 actgacccccatcaac-aagcttcaagggctctctccggagcagattgttactgaagcaa 773
| | ||| ||||| || |||||| | |||||||| | || ||||| || ||||||||
Sbjct: 700 attcaccaccatccaccaagcttgaggggctctcctctaagaagattattgctgaagcat 641
Query: 774 gccaaaacccgaggcacaccctcgcta-ggaccatcgacaccaggaatgaaatccatcct 832
|| | ||| || || |||||||| || || || || | ||| |||||||| ||||| ||
Sbjct: 640 gcaagaacacggggaacaccctcactttggtccgtcaataccgggaatgaagtccattct 581
Query: 833 tggcccaatccaattaaaaggtctcacgattgtgaattcaaggccattttctgcaccttc 892
|| || ||||||||||| || ||||| |||||||| || | ||| ||||| ||||| ||
Sbjct: 580 aggtccgatccaattaaagggcctcacaattgtgaactccaagccgttttcagcaccctc 521
Query: 893 agcaaatacaagcctctcaataagttgcttcgcgcaagcataggaccatctttgtttcac 952
|||| | || ||||||||||| | ||||| || || ||||| |||||||| || || |
Sbjct: 520 agcataaaccagcctctcaatcaactgctttgcacatgcatatgaccatctctgcttttc 461
Query: 953 gattggaccaaaaatacagggcgactcatcttctttaag 991
||||| ||| ||||| || || ||| |||||||||||||
Sbjct: 460 gattgaaccgaaaatgcatggagacacatcttctttaag 422
Score = 44.1 bits (22), Expect = 0.037
Identities = 46/54 (85%)
Strand = Plus / Minus
Query: 1211 cagatcggccatcttgatgagcccctcgagcctggagtcattcttgatgttaag 1264
|||||| |||||||||||||| || || ||||| || || |||||||| |||||
Sbjct: 202 cagatctgccatcttgatgagaccttcaagccttgaatcgttcttgatattaag 149
>gb|BE203279.1|BE203279 EST403301 KV1 Medicago truncatula cDNA clone pKV1-5C23, mRNA
sequence
Length = 575
Score = 91.7 bits (46), Expect = 2e-016
Identities = 130/158 (82%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 234 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 175
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 174 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 115
Query: 710 ctgagactgacccccatcaacaagcttcaagggctctc 747
|| || | ||| ||||| |||||||| | ||||||||
Sbjct: 114 gtgggattcaccaccatccacaagcttgaggggctctc 77
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 410 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 351
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 350 ctatcatcatatcc 337
>gb|AW560933.1|AW560933 EST315981 DSIR Medicago truncatula cDNA clone pDSIR-30F23, mRNA
sequence
Length = 701
Score = 87.7 bits (44), Expect = 3e-015
Identities = 143/176 (81%)
Strand = Plus / Minus
Query: 816 ggaatgaaatccatccttggcccaatccaattaaaaggtctcacgattgtgaattcaagg 875
|||||||| ||||| || || || ||||||||||| || ||||| |||||||| || | |
Sbjct: 700 ggaatgaagtccattctaggtccgatccaattaaagggcctcacaattgtgaactccaag 641
Query: 876 ccattttctgcaccttcagcaaatacaagcctctcaataagttgcttcgcgcaagcatag 935
|| ||||| |||||||||||| | || ||||||||||| | ||||| || || |||||
Sbjct: 640 ccgttttcagcaccttcagcataaaccagcctctcaatcaactgctttgcacatgcatat 581
Query: 936 gaccatctttgtttcacgattggaccaaaaatacagggcgactcatcttctttaag 991
|||||||| || || |||||| ||| ||||| || || ||| |||||||||||||
Sbjct: 580 gaccatctctgcttttcgattgaaccgaaaatgcatggagacacatcttctttaag 525
Score = 61.9 bits (31), Expect = 2e-007
Identities = 55/63 (87%)
Strand = Plus / Minus
Query: 1373 catgagcttctcgcagaggtgggagccgatgaagccgccggcgccaatcatgcagatggt 1432
|||||| || |||||||| || || ||||||||||| ||||| |||||||||||||| ||
Sbjct: 143 catgagtttttcgcagagatgagaaccgatgaagccaccggcaccaatcatgcagattgt 84
Query: 1433 gag 1435
|||
Sbjct: 83 gag 81
Score = 46.1 bits (23), Expect = 0.009
Identities = 122/155 (78%)
Strand = Plus / Minus
Query: 1110 tacttgaccactgggagtgcatcgatgaagttgctgtagatggtgtcaagggggcgagtg 1169
||||| ||||| || |||||||| ||||| ||||| || || || ||||| || || ||
Sbjct: 406 tacttcaccacaggaagtgcatcaatgaaattgctataaattgtatcaagaggacgtgta 347
Query: 1170 ttgtagtccgccggcgtgcagatagccgccaggttgatggtcagatcggccatcttgatg 1229
|||||||| || || || || || || ||||| || || |||||| ||||||||||||
Sbjct: 346 ttgtagtcagcaggagtacaaattgcagccagatttataaccagatctgccatcttgatg 287
Query: 1230 agcccctcgagcctggagtcattcttgatgttaag 1264
|| || || ||||| || || |||||||| |||||
Sbjct: 286 agaccttcaagccttgaatcgttcttgatattaag 252
>gb|CB894212.1|CB894212 EST647004 HOGA Medicago truncatula cDNA clone HOGA-30O4, mRNA
sequence
Length = 387
Score = 87.7 bits (44), Expect = 3e-015
Identities = 236/300 (78%)
Strand = Plus / Minus
Query: 692 gatgtagacaaaggttctctgagactgacccccatcaacaagcttcaagggctctctccg 751
|||||| ||||| |||||||| || | ||| ||||| |||||||| | |||||||| |
Sbjct: 387 gatgtaaacaaatgttctctgggattcaccaccatccacaagcttgaggggctctcctct 328
Query: 752 gagcagattgttactgaagcaagccaaaacccgaggcacaccctcgctaggaccatcgac 811
|| ||||| || |||||||| || | ||| || || |||||||| || || || || |
Sbjct: 327 aagaagattattgctgaagcatgcaagaacacggggaacaccctcacttggtccgtcaat 268
Query: 812 accaggaatgaaatccatccttggcccaatccaattaaaaggtctcacgattgtgaattc 871
||| |||||||| ||||| || || || ||||||||||| || ||||| |||||||| ||
Sbjct: 267 accgggaatgaagtccattctaggtccgatccaattaaagggcctcacaattgtgaactc 208
Query: 872 aaggccattttctgcaccttcagcaaatacaagcctctcaataagttgcttcgcgcaagc 931
| ||| ||||| ||||| |||||| | || ||||||||||| | ||||| || || ||
Sbjct: 207 caagccgttttcagcaccctcagcataaaccagcctctcaatcaactgctttgcacatgc 148
Query: 932 ataggaccatctttgtttcacgattggaccaaaaatacagggcgactcatcttctttaag 991
||| |||||||| || || |||||| ||| ||||| || || ||| | |||||||||||
Sbjct: 147 atatgaccatctctgcttttcgattgaaccgaaaatgcatggagacacttcttctttaag 88
>gb|BQ122467.1|BQ122467 EST608043 GLSD Medicago truncatula cDNA clone pGLSD-29E19, mRNA
sequence
Length = 726
Score = 85.7 bits (43), Expect = 1e-014
Identities = 103/123 (83%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 131 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 72
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttct 709
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| |||||
Sbjct: 71 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttct 12
Query: 710 ctg 712
|||
Sbjct: 11 ctg 9
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 307 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 248
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 247 ctatcatcatatcc 234
>gb|BG455787.1|BG455787 NF070B03PL1F1027 Phosphate starved leaf Medicago truncatula cDNA
clone NF070B03PL 5', mRNA sequence
Length = 669
Score = 81.8 bits (41), Expect = 2e-013
Identities = 142/176 (80%)
Strand = Plus / Minus
Query: 816 ggaatgaaatccatccttggcccaatccaattaaaaggtctcacgattgtgaattcaagg 875
|||||||| ||||| || || || ||||||||||| || ||||| |||||||| || | |
Sbjct: 640 ggaatgaagtccattctaggtccgatccaattaaagggcctcacaattgtgaactccaag 581
Query: 876 ccattttctgcaccttcagcaaatacaagcctctcaataagttgcttcgcgcaagcatag 935
|| ||||| ||||| |||||| | || ||||||||||| | ||||| || || |||||
Sbjct: 580 ccgttttcagcaccntcagcataaaccagcctctcaatcaactgctttgcacatgcatat 521
Query: 936 gaccatctttgtttcacgattggaccaaaaatacagggcgactcatcttctttaag 991
|||||||| || || |||||| ||| ||||| || || ||| |||||||||||||
Sbjct: 520 gaccatctctgcttttcgattgaaccgaaaatgcatggagacacatcttctttaag 465
Score = 61.9 bits (31), Expect = 2e-007
Identities = 55/63 (87%)
Strand = Plus / Minus
Query: 1373 catgagcttctcgcagaggtgggagccgatgaagccgccggcgccaatcatgcagatggt 1432
|||||| || |||||||| || || ||||||||||| ||||| |||||||||||||| ||
Sbjct: 83 catgagtttttcgcagagatgagaaccgatgaagccaccggcaccaatcatgcagattgt 24
Query: 1433 gag 1435
|||
Sbjct: 23 gag 21
Score = 44.1 bits (22), Expect = 0.037
Identities = 46/54 (85%)
Strand = Plus / Minus
Query: 1211 cagatcggccatcttgatgagcccctcgagcctggagtcattcttgatgttaag 1264
|||||| |||||||||||||| || || ||||| || || |||||||| |||||
Sbjct: 245 cagatctgccatcttgatgagaccttcaagccttgaatcgttcttgatattaag 192
>gb|BG644894.1|BG644894 EST506513 KV3 Medicago truncatula cDNA clone pKV3-38L17 5' end,
mRNA sequence
Length = 740
Score = 81.8 bits (41), Expect = 2e-013
Identities = 212/269 (78%)
Strand = Plus / Minus
Query: 723 ccatcaacaagcttcaagggctctctccggagcagattgttactgaagcaagccaaaacc 782
||||| |||||||| | |||||||| | || ||||| || |||||||| || | |||
Sbjct: 737 ccatccacaagcttgaggggctctcctctaagaagattattgctgaagcatgcaagaaca 678
Query: 783 cgaggcacaccctcgctaggaccatcgacaccaggaatgaaatccatccttggcccaatc 842
|| || |||||||| || || || || | ||| |||||||| ||||| || || || |||
Sbjct: 677 cggggaacaccctcccttggtccgtcaataccgggaatgaagtccattctaggtccgatc 618
Query: 843 caattaaaaggtctcacgattgtgaattcaaggccattttctgcaccttcagcaaataca 902
|||||||| || ||||| |||||||| || | ||| ||||| ||||| |||||| | ||
Sbjct: 617 caattaaagggcctcacaattgtgaactccaagccgttttcagcaccctcagcataaacc 558
Query: 903 agcctctcaataagttgcttcgcgcaagcataggaccatctttgtttcacgattggacca 962
||||||||||| | ||||| || || ||||| |||||||| || || |||||| |||
Sbjct: 557 agcctctcaatcaactgctttgcacatgcatatgaccatctctgcttttcgattgaaccg 498
Query: 963 aaaatacagggcgactcatcttctttaag 991
||||| || || ||| |||||||||||||
Sbjct: 497 aaaatgcatggagacacatcttctttaag 469
Score = 61.9 bits (31), Expect = 2e-007
Identities = 55/63 (87%)
Strand = Plus / Minus
Query: 1373 catgagcttctcgcagaggtgggagccgatgaagccgccggcgccaatcatgcagatggt 1432
|||||| || |||||||| || || ||||||||||| ||||| |||||||||||||| ||
Sbjct: 87 catgagtttttcgcagagatgagaaccgatgaagccaccggcaccaatcatgcagattgt 28
Query: 1433 gag 1435
|||
Sbjct: 27 gag 25
Score = 44.1 bits (22), Expect = 0.037
Identities = 46/54 (85%)
Strand = Plus / Minus
Query: 1211 cagatcggccatcttgatgagcccctcgagcctggagtcattcttgatgttaag 1264
|||||| |||||||||||||| || || ||||| || || |||||||| |||||
Sbjct: 249 cagatctgccatcttgatgagaccttcaagccttgaatcgttcttgatattaag 196
>gb|AW776813.1|AW776813 EST335878 DSIL Medicago truncatula cDNA clone pDSIL-16A6, mRNA
sequence
Length = 576
Score = 79.8 bits (40), Expect = 7e-013
Identities = 142/176 (80%)
Strand = Plus / Minus
Query: 816 ggaatgaaatccatccttggcccaatccaattaaaaggtctcacgattgtgaattcaagg 875
|||||||| ||||| || || || ||||||||||| || ||||| |||||||| || | |
Sbjct: 541 ggaatgaagtccattctaggtccgatccaattaaagggcctcacaattgtgaactccaag 482
Query: 876 ccattttctgcaccttcagcaaatacaagcctctcaataagttgcttcgcgcaagcatag 935
|| ||||| ||||| |||||| | || ||||||||||| | ||||| || || |||||
Sbjct: 481 ccgttttcagcaccctcagcataaaccagcctctcaatcaactgctttgcacatgcatat 422
Query: 936 gaccatctttgtttcacgattggaccaaaaatacagggcgactcatcttctttaag 991
|||||||| || || |||||| ||| ||||| || || ||| |||||||||||||
Sbjct: 421 gaccatctctgcttttcgattgaaccgaaaatgcatggagacacatcttctttaag 366
>gb|BE322743.2|BE322743 NF047D11IN1F1091 Insect herbivory Medicago truncatula cDNA clone
NF047D11IN 5', mRNA sequence
Length = 539
Score = 79.8 bits (40), Expect = 7e-013
Identities = 142/176 (80%)
Strand = Plus / Minus
Query: 816 ggaatgaaatccatccttggcccaatccaattaaaaggtctcacgattgtgaattcaagg 875
|||||||| ||||| || || || ||||||||||| || ||||| |||||||| || | |
Sbjct: 455 ggaatgaagtccattctaggtccgatccaattaaagggcctcacaattgtgaactccaag 396
Query: 876 ccattttctgcaccttcagcaaatacaagcctctcaataagttgcttcgcgcaagcatag 935
|| ||||| ||||| |||||| | || ||||||||||| | ||||| || || |||||
Sbjct: 395 ccgttttcagcaccctcagcataaaccagcctctcaatcaactgctttgcacatgcatat 336
Query: 936 gaccatctttgtttcacgattggaccaaaaatacagggcgactcatcttctttaag 991
|||||||| || || |||||| ||| ||||| || || ||| |||||||||||||
Sbjct: 335 gaccatctctgcttttcgattgaaccgaaaatgcatggagacacatcttctttaag 280
Score = 44.1 bits (22), Expect = 0.037
Identities = 46/54 (85%)
Strand = Plus / Minus
Query: 1211 cagatcggccatcttgatgagcccctcgagcctggagtcattcttgatgttaag 1264
|||||| |||||||||||||| || || ||||| || || |||||||| |||||
Sbjct: 60 cagatctgccatcttgatgagaccttcaagccttgaatcgttcttgatattaag 7
>gb|BG647217.1|BG647217 EST508836 HOGA Medicago truncatula cDNA clone pHOGA-16C17 5' end,
mRNA sequence
Length = 707
Score = 79.8 bits (40), Expect = 7e-013
Identities = 142/176 (80%)
Strand = Plus / Minus
Query: 816 ggaatgaaatccatccttggcccaatccaattaaaaggtctcacgattgtgaattcaagg 875
|||||||| ||||| || || || ||||||||||| || ||||| |||||||| || | |
Sbjct: 652 ggaatgaagtccattctaggtccgatccaattaaagggcctcacaattgtgaactccaag 593
Query: 876 ccattttctgcaccttcagcaaatacaagcctctcaataagttgcttcgcgcaagcatag 935
|| ||||| ||||| |||||| | || ||||||||||| | ||||| || || |||||
Sbjct: 592 ccgttttcagcaccctcagcataaaccagcctctcaatcaactgctttgcacatgcatat 533
Query: 936 gaccatctttgtttcacgattggaccaaaaatacagggcgactcatcttctttaag 991
|||||||| || || |||||| ||| ||||| || || ||| |||||||||||||
Sbjct: 532 gaccatctctgcttttcgattgaaccgaaaatgcatggagacacatcttctttaag 477
Score = 61.9 bits (31), Expect = 2e-007
Identities = 55/63 (87%)
Strand = Plus / Minus
Query: 1373 catgagcttctcgcagaggtgggagccgatgaagccgccggcgccaatcatgcagatggt 1432
|||||| || |||||||| || || ||||||||||| ||||| |||||||||||||| ||
Sbjct: 95 catgagtttttcgcagagatgagaaccgatgaagccaccggcaccaatcatgcagattgt 36
Query: 1433 gag 1435
|||
Sbjct: 35 gag 33
Score = 44.1 bits (22), Expect = 0.037
Identities = 46/54 (85%)
Strand = Plus / Minus
Query: 1211 cagatcggccatcttgatgagcccctcgagcctggagtcattcttgatgttaag 1264
|||||| |||||||||||||| || || ||||| || || |||||||| |||||
Sbjct: 257 cagatctgccatcttgatgagaccttcaagccttgaatcgttcttgatattaag 204
>gb|BQ079357.1|BQ079357 MtNo1193 Medicago truncatula R108 Medicago truncatula cDNA clone
MtNo1193 5', mRNA sequence
Length = 631
Score = 79.8 bits (40), Expect = 7e-013
Identities = 142/176 (80%)
Strand = Plus / Minus
Query: 816 ggaatgaaatccatccttggcccaatccaattaaaaggtctcacgattgtgaattcaagg 875
|||||||| ||||| || || || ||||||||||| || ||||| |||||||| || | |
Sbjct: 407 ggaatgaagtccattctaggtccgatccaattaaagggcctcacaattgtgaactccaag 348
Query: 876 ccattttctgcaccttcagcaaatacaagcctctcaataagttgcttcgcgcaagcatag 935
|| ||||| ||||| |||||| | || ||||||||||| | ||||| || || |||||
Sbjct: 347 ccgttttcagcaccctcagcataaaccagcctctcaatcaactgctttgcacatgcatat 288
Query: 936 gaccatctttgtttcacgattggaccaaaaatacagggcgactcatcttctttaag 991
|||||||| || || |||||| ||| ||||| || || ||| |||||||||||||
Sbjct: 287 gaccatctctgcttttcgattgaaccgaaaatgcatggagacacatcttctttaag 232
>gb|CB891065.1|CB891065 EST648034 KV3 Medicago truncatula cDNA clone KV3-49C9, mRNA
sequence
Length = 800
Score = 77.8 bits (39), Expect = 3e-012
Identities = 99/119 (83%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 485 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 426
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaaggttc 708
||| ||||||||||||| | |||||||| |||||||| |||||||| ||||| ||||
Sbjct: 425 agggttttcaatcatcaataagacagcttcaatagcatctttgatgtaaacaaatgttc 367
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 661 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 602
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 601 ctatcatcatatcc 588
>gb|AC144515.14| Medicago truncatula clone mth2-5j8, complete sequence
Length = 119095
Score = 77.8 bits (39), Expect = 3e-012
Identities = 90/107 (84%)
Strand = Plus / Minus
Query: 762 ttactgaagcaagccaaaacccgaggcacaccctcgctaggaccatcgacaccaggaatg 821
|||||||||||||| ||||| | || ||||| || || |||||||| || |||||||||
Sbjct: 88025 ttactgaagcaagctaaaactcttgggacaccatcacttggaccatccactccaggaatg 87966
Query: 822 aaatccatccttggcccaatccaattaaaaggtctcacgattgtgaa 868
|| ||||| ||||| |||||||| ||| |||||||||| || |||||
Sbjct: 87965 aagtccattcttggtccaatccagttataaggtctcacaatagtgaa 87919
Score = 44.1 bits (22), Expect = 0.037
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 684 gcatccttgatgtagacaaaggttctctgagactgacccccatcaacaag 733
||||| ||||| |||| |||||||||||| || || || |||||||||||
Sbjct: 88202 gcatctttgatatagagaaaggttctctgggaatgtccaccatcaacaag 88153
>gb|CG971326.1|CG971326 MBEFK53TF mth2 Medicago truncatula genomic clone 44J9, DNA sequence
Length = 708
Score = 73.8 bits (37), Expect = 4e-011
Identities = 133/165 (80%)
Strand = Plus / Minus
Query: 571 tcatcatttgggccaactccctaacggtaacttcattgttcggattcccaacattgaaga 630
||||||||| |||| ||||| ||| ||||| ||||||||||| || || ||||| || |
Sbjct: 165 tcatcatttcagccagctcccgaaccgtaacctcattgttcgggttacccacattaaata 106
Query: 631 tgtggccattggctcgagcaggattttcaatcatcagcactacagcttcgatagcatcct 690
| | ||||| |||| |||||| ||||||||||||| || || ||||| |||||||| |
Sbjct: 105 tcttcccattagctctagcagggttttcaatcatcaacaacactgcttcaatagcatctt 46
Query: 691 tgatgtagacaaaggttctctgagactgacccccatcaacaagct 735
|||| || | | | || |||||||||| ||| ||||| |||||||
Sbjct: 45 tgatataaagataagtcctctgagactcaccaccatccacaagct 1
Score = 69.9 bits (35), Expect = 7e-010
Identities = 71/83 (85%)
Strand = Plus / Minus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| || |||||||||||||| || |||||||| || || ||||||||
Sbjct: 322 gtctttggattccatccaagctgcttgttgatgatggtcatgtcaggaattctcttgtca 263
Query: 474 ctatcatcgtatccttcgccgta 496
|||||||| ||||| || |||||
Sbjct: 262 ctatcatcatatccctcaccgta 240
>emb|CR497236.1| mth2-173K15FM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 341
Score = 73.8 bits (37), Expect = 4e-011
Identities = 133/165 (80%)
Strand = Plus / Minus
Query: 571 tcatcatttgggccaactccctaacggtaacttcattgttcggattcccaacattgaaga 630
||||||||| |||| ||||| ||| ||||| ||||||||||| || || ||||| || |
Sbjct: 165 tcatcatttcagccagctcccgaaccgtaacctcattgttcgggttacccacattaaata 106
Query: 631 tgtggccattggctcgagcaggattttcaatcatcagcactacagcttcgatagcatcct 690
| | ||||| |||| |||||| ||||||||||||| || || ||||| |||||||| |
Sbjct: 105 tcttcccattagctctagcagggttttcaatcatcaacaacactgcttcaatagcatctt 46
Query: 691 tgatgtagacaaaggttctctgagactgacccccatcaacaagct 735
|||| || | | | || |||||||||| ||| ||||| |||||||
Sbjct: 45 tgatataaagataagtcctctgagactcaccaccatccacaagct 1
Score = 58.0 bits (29), Expect = 2e-006
Identities = 56/65 (86%)
Strand = Plus / Minus
Query: 432 agctgcttgttgattatagtcatgtcggggatcctcttgtcgctatcatcgtatccttcg 491
|||||||||||||| || |||||||| || || |||||||| |||||||| ||||| ||
Sbjct: 304 agctgcttgttgatgatggtcatgtcaggaattctcttgtcactatcatcatatccctca 245
Query: 492 ccgta 496
|||||
Sbjct: 244 ccgta 240
>gb|BQ122194.1|BQ122194 EST607770 GLSD Medicago truncatula cDNA clone pGLSD-28A16, mRNA
sequence
Length = 501
Score = 73.8 bits (37), Expect = 4e-011
Identities = 154/193 (79%)
Strand = Plus / Minus
Query: 672 acagcttcgatagcatccttgatgtagacaaaggttctctgagactgacccccatcaaca 731
|||||||| |||||||| |||||||| ||||| |||||||| || | ||| ||||| |||
Sbjct: 219 acagcttcaatagcatctttgatgtaaacaaatgttctctgggattcaccaccatccaca 160
Query: 732 agcttcaagggctctctccggagcagattgttactgaagcaagccaaaacccgaggcaca 791
||||| | |||||||| | || ||||| || |||||||| || | ||| || || |||
Sbjct: 159 agcttgaggggctctcctctaagaagattattgctgaagcatgcaagaacacggggaaca 100
Query: 792 ccctcgctaggaccatcgacaccaggaatgaaatccatccttggcccaatccaattaaaa 851
||||| || || || || | ||| |||||||| ||||| || || || |||||||||||
Sbjct: 99 ccctcacttggtccgtcaataccgggaatgaagtccattctaggtccgatccaattaaag 40
Query: 852 ggtctcacgattg 864
|| ||||| ||||
Sbjct: 39 ggcctcacaattg 27
Score = 42.1 bits (21), Expect = 0.15
Identities = 57/69 (82%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 386 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 327
Query: 650 aggattttc 658
||| |||||
Sbjct: 326 agggttttc 318
>gb|BE999198.1|BE999198 EST430921 GVSN Medicago truncatula cDNA clone pGVSN-15B7, mRNA
sequence
Length = 550
Score = 71.9 bits (36), Expect = 2e-010
Identities = 141/176 (80%)
Strand = Plus / Minus
Query: 816 ggaatgaaatccatccttggcccaatccaattaaaaggtctcacgattgtgaattcaagg 875
|||||||| ||||| || || || ||||||||||| || ||||| ||||||| | | | |
Sbjct: 504 ggaatgaagtccattctaggtccgatccaattaaagggcctcacaattgtgactcccaag 445
Query: 876 ccattttctgcaccttcagcaaatacaagcctctcaataagttgcttcgcgcaagcatag 935
|| ||||| ||||| |||||| | || ||||||||||| | ||||| || || |||||
Sbjct: 444 ccgttttcagcaccctcagcataaaccagcctctcaatcaactgctttgcacatgcatat 385
Query: 936 gaccatctttgtttcacgattggaccaaaaatacagggcgactcatcttctttaag 991
|||||||| || || |||||| ||| ||||| || || ||| |||||||||||||
Sbjct: 384 gaccatctctgcttttcgattgaaccgaaaatgcatggagacacatcttctttaag 329
Score = 44.1 bits (22), Expect = 0.037
Identities = 46/54 (85%)
Strand = Plus / Minus
Query: 1211 cagatcggccatcttgatgagcccctcgagcctggagtcattcttgatgttaag 1264
|||||| |||||||||||||| || || ||||| || || |||||||| |||||
Sbjct: 109 cagatctgccatcttgatgagaccttcaagccttgaatcgttcttgatattaag 56
>gb|CX530539.1|CX530539 s13dNF43F03MJ028_247099 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 491
Score = 71.9 bits (36), Expect = 2e-010
Identities = 95/115 (82%)
Strand = Plus / Minus
Query: 590 cctaacggtaacttcattgttcggattcccaacattgaagatgtggccattggctcgagc 649
|||||| ||||| |||||||| || || || ||||| || || ||||||||||||| ||
Sbjct: 162 cctaactgtaacctcattgtttgggttacccacattaaaaatatggccattggctctggc 103
Query: 650 aggattttcaatcatcagcactacagcttcgatagcatccttgatgtagacaaag 704
||| ||||||||||||| | |||||||| |||||||| ||| |||| ||||||
Sbjct: 102 agggttttcaatcatcaataagacagcttcaatagcatctttgntgtaaacaaag 48
>gb|CG937141.1|CG937141 MBEDL31TFC mth2 Medicago truncatula genomic clone 32F14, DNA
sequence
Length = 819
Score = 69.9 bits (35), Expect = 7e-010
Identities = 71/83 (85%)
Strand = Plus / Minus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| || |||||||||||||| || |||||||| || || ||||||||
Sbjct: 323 gtctttggattccatccaagctgcttgttgatgatggtcatgtcaggaattctcttgtca 264
Query: 474 ctatcatcgtatccttcgccgta 496
|||||||| ||||| || |||||
Sbjct: 263 ctatcatcatatccctcaccgta 241
Score = 60.0 bits (30), Expect = 6e-007
Identities = 133/166 (80%), Gaps = 1/166 (0%)
Strand = Plus / Minus
Query: 571 tcatcatttgggccaactccctaacggtaacttcattgttcggattcccaacattgaaga 630
||||||||| |||| ||||| ||| ||||| ||||||||||| || || ||||| || |
Sbjct: 166 tcatcatttcagccagctcccgaaccgtaacctcattgttcgggttacccacattaaata 107
Query: 631 tgtggc-cattggctcgagcaggattttcaatcatcagcactacagcttcgatagcatcc 689
| | | |||| |||| |||||| ||||||||||||| || || ||||| ||||||||
Sbjct: 106 tcttccgcattagctctagcagggttttcaatcatcaacaacactgcttcaatagcatct 47
Query: 690 ttgatgtagacaaaggttctctgagactgacccccatcaacaagct 735
||||| || | | | || |||||||||| ||| ||||| |||||||
Sbjct: 46 ttgatataaagataagtcctctgagactcaccaccatccacaagct 1
>gb|BE322910.1|BE322910 NF025F04IN1F1032 Insect herbivory Medicago truncatula cDNA clone
NF025F04IN 5', mRNA sequence
Length = 676
Score = 69.9 bits (35), Expect = 7e-010
Identities = 119/147 (80%)
Strand = Plus / Minus
Query: 845 attaaaaggtctcacgattgtgaattcaaggccattttctgcaccttcagcaaatacaag 904
|||||| || ||||| |||||||| || | ||| ||||| |||||||||||| | || ||
Sbjct: 676 attaaagggcctcacaattgtgaactccaagccgttttcagcaccttcagcataaaccag 617
Query: 905 cctctcaataagttgcttcgcgcaagcataggaccatctttgtttcacgattggaccaaa 964
||||||||| | ||||| || || ||||| |||||||| || || |||||| ||| ||
Sbjct: 616 cctctcaatcaactgctttgcacatgcatatgaccatctctgcttttcgattgaaccgaa 557
Query: 965 aatacagggcgactcatcttctttaag 991
||| || || ||| |||||||||||||
Sbjct: 556 aatgcatggagacacatcttctttaag 530
Score = 61.9 bits (31), Expect = 2e-007
Identities = 55/63 (87%)
Strand = Plus / Minus
Query: 1373 catgagcttctcgcagaggtgggagccgatgaagccgccggcgccaatcatgcagatggt 1432
|||||| || |||||||| || || ||||||||||| ||||| |||||||||||||| ||
Sbjct: 148 catgagtttttcgcagagatgagaaccgatgaagccaccggcaccaatcatgcagattgt 89
Query: 1433 gag 1435
|||
Sbjct: 88 gag 86
Score = 44.1 bits (22), Expect = 0.037
Identities = 46/54 (85%)
Strand = Plus / Minus
Query: 1211 cagatcggccatcttgatgagcccctcgagcctggagtcattcttgatgttaag 1264
|||||| |||||||||||||| || || ||||| || || |||||||| |||||
Sbjct: 310 cagatctgccatcttgatgagaccttcaagccttgaatcgttcttgatattaag 257
>gb|BE205188.1|BE205188 EST397864 KV0 Medicago truncatula cDNA clone pKV0-20J17, mRNA
sequence
Length = 630
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Plus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 540 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 599
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 600 ctatcatcatatcc 613
>gb|AL385160.1|AL385160 MtBC26G03F1 MtBC Medicago truncatula cDNA clone MtBC26G03 T3, mRNA
sequence
Length = 464
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 239 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 180
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 179 ctatcatcatatcc 166
>gb|BE941504.1|BE941504 EST421083 MGHG Medicago truncatula cDNA clone pMGHG-4O17, mRNA
sequence
Length = 592
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 89 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 30
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 29 ctatcatcatatcc 16
>gb|BF641008.1|BF641008 NF031H06IN1F1059 Insect herbivory Medicago truncatula cDNA clone
NF031H06IN 5', mRNA sequence
Length = 634
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Plus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 423 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 482
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 483 ctatcatcatatcc 496
>gb|BE315720.2|BE315720 NF025G10LF1F1072 Developing leaf Medicago truncatula cDNA clone
NF025G10LF 5', mRNA sequence
Length = 472
Score = 67.9 bits (34), Expect = 3e-009
Identities = 64/74 (86%)
Strand = Plus / Minus
Query: 414 gtctttgggttccaacctagctgcttgttgattatagtcatgtcggggatcctcttgtcg 473
|||||||| ||||| | ||||||||||||||||| |||||||| || || ||||||||
Sbjct: 178 gtctttggattccattcgagctgcttgttgattatggtcatgtcaggaattctcttgtca 119
Query: 474 ctatcatcgtatcc 487
|||||||| |||||
Sbjct: 118 ctatcatcatatcc 105
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 292,706
Number of Sequences: 392609
Number of extensions: 292706
Number of successful extensions: 22129
Number of sequences better than 0.5: 164
Number of HSP's better than 0.5 without gapping: 164
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 21727
Number of HSP's gapped (non-prelim): 380
length of query: 1644
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1624
effective length of database: 433,880,813
effective search space: 704622440312
effective search space used: 704622440312
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)