BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2404800.2.1
(1228 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BE203892.1|BE203892 EST396568 KV0 Medicago truncatula cD... 44 0.028
gb|BE205075.1|BE205075 EST397751 KV0 Medicago truncatula cD... 44 0.028
gb|CA922576.1|CA922576 EST640294 MTUS Medicago truncatula c... 44 0.028
gb|CG969046.1|CG969046 MBEIF17TF mth2 Medicago truncatula g... 40 0.43
emb|CR492299.1| mth2-166I21RM1 BAC end, cultivar Jemalong A... 40 0.43
emb|CR294197.1| mte1-1P16RM1 BAC end, cultivar Jemalong A17... 40 0.43
>gb|BE203892.1|BE203892 EST396568 KV0 Medicago truncatula cDNA clone pKV0-13I19, mRNA
sequence
Length = 585
Score = 44.1 bits (22), Expect = 0.028
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 451 catcgccccagtcatgcaaaacccacttaa 480
|||| ||||| |||||||||||||||||||
Sbjct: 510 catccccccaatcatgcaaaacccacttaa 481
>gb|BE205075.1|BE205075 EST397751 KV0 Medicago truncatula cDNA clone pKV0-20C8, mRNA
sequence
Length = 375
Score = 44.1 bits (22), Expect = 0.028
Identities = 28/30 (93%)
Strand = Plus / Minus
Query: 451 catcgccccagtcatgcaaaacccacttaa 480
|||| ||||| |||||||||||||||||||
Sbjct: 248 catccccccaatcatgcaaaacccacttaa 219
>gb|CA922576.1|CA922576 EST640294 MTUS Medicago truncatula cDNA clone MTUS-55E7, mRNA
sequence
Length = 809
Score = 44.1 bits (22), Expect = 0.028
Identities = 28/30 (93%)
Strand = Plus / Plus
Query: 451 catcgccccagtcatgcaaaacccacttaa 480
|||| ||||| |||||||||||||||||||
Sbjct: 612 catccccccaatcatgcaaaacccacttaa 641
>gb|CG969046.1|CG969046 MBEIF17TF mth2 Medicago truncatula genomic clone 61C10, DNA
sequence
Length = 923
Score = 40.1 bits (20), Expect = 0.43
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 458 ccagtcatgcaaaacccact 477
||||||||||||||||||||
Sbjct: 761 ccagtcatgcaaaacccact 742
>emb|CR492299.1| mth2-166I21RM1 BAC end, cultivar Jemalong A17 of Medicago
truncatula, genomic survey sequence
Length = 603
Score = 40.1 bits (20), Expect = 0.43
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 458 ccagtcatgcaaaacccact 477
||||||||||||||||||||
Sbjct: 443 ccagtcatgcaaaacccact 424
>emb|CR294197.1| mte1-1P16RM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 811
Score = 40.1 bits (20), Expect = 0.43
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 458 ccagtcatgcaaaacccact 477
||||||||||||||||||||
Sbjct: 323 ccagtcatgcaaaacccact 342
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 197,108
Number of Sequences: 392609
Number of extensions: 197108
Number of successful extensions: 14295
Number of sequences better than 0.5: 6
Number of HSP's better than 0.5 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14289
Number of HSP's gapped (non-prelim): 6
length of query: 1228
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1208
effective length of database: 433,880,813
effective search space: 524128022104
effective search space used: 524128022104
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)