BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2192890.2.1
         (531 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|BE321531.2|BE321531  NF024C12IN1F1086 Insect herbivory Me...    40   0.18 
gb|AC145372.6|  Medicago truncatula clone mth2-5f4, complete...    40   0.18 
gb|AC137521.31|  Medicago truncatula clone mth2-11o9, WORKIN...    40   0.18 

>gb|BE321531.2|BE321531 NF024C12IN1F1086 Insect herbivory Medicago truncatula cDNA clone
           NF024C12IN 5', mRNA sequence
          Length = 597

 Score = 40.1 bits (20), Expect = 0.18
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 249 ttgtttacttggatcctatg 268
           ||||||||||||||||||||
Sbjct: 517 ttgtttacttggatcctatg 536



>gb|AC145372.6| Medicago truncatula clone mth2-5f4, complete sequence
          Length = 94657

 Score = 40.1 bits (20), Expect = 0.18
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 453  atttttgatttgatgggtta 472
            ||||||||||||||||||||
Sbjct: 1631 atttttgatttgatgggtta 1612



>gb|AC137521.31| Medicago truncatula clone mth2-11o9, WORKING DRAFT SEQUENCE, 16
             unordered pieces
          Length = 291529

 Score = 40.1 bits (20), Expect = 0.18
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 453   atttttgatttgatgggtta 472
             ||||||||||||||||||||
Sbjct: 51962 atttttgatttgatgggtta 51981



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 147,037
Number of Sequences: 392609
Number of extensions: 147037
Number of successful extensions: 10990
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 10971
Number of HSP's gapped (non-prelim): 19
length of query: 531
length of database: 441,732,993
effective HSP length: 19
effective length of query: 512
effective length of database: 434,273,422
effective search space: 222347992064
effective search space used: 222347992064
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)