BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2188214.2.1
         (880 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

emb|CR330228.1|  mte1-59N8FM1 BAC end, cultivar Jemalong A17...    42   0.078
gb|AC140027.11|  Medicago truncatula clone mth2-5m21, comple...    42   0.078
gb|AC146703.19|  Medicago truncatula clone mth2-22o12, WORKI...    42   0.078
>emb|CR330228.1| mte1-59N8FM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
           genomic survey sequence
          Length = 686

 Score = 42.1 bits (21), Expect = 0.078
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 46  ataaagtttgaaatagaggatgaaa 70
           ||||| |||||||||||||||||||
Sbjct: 142 ataaactttgaaatagaggatgaaa 118
>gb|AC140027.11| Medicago truncatula clone mth2-5m21, complete sequence
          Length = 131365

 Score = 42.1 bits (21), Expect = 0.078
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 533   tgctatttcagatctgacggt 553
             |||||||||||||||||||||
Sbjct: 56623 tgctatttcagatctgacggt 56603
>gb|AC146703.19| Medicago truncatula clone mth2-22o12, WORKING DRAFT SEQUENCE, 25
             unordered pieces
          Length = 235128

 Score = 42.1 bits (21), Expect = 0.078
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 533   tgctatttcagatctgacggt 553
             |||||||||||||||||||||
Sbjct: 16921 tgctatttcagatctgacggt 16901
  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 172,503
Number of Sequences: 392609
Number of extensions: 172503
Number of successful extensions: 12795
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 12786
Number of HSP's gapped (non-prelim): 9
length of query: 880
length of database: 441,732,993
effective HSP length: 20
effective length of query: 860
effective length of database: 433,880,813
effective search space: 373137499180
effective search space used: 373137499180
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)