BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2188214.2.1
(880 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|CR330228.1| mte1-59N8FM1 BAC end, cultivar Jemalong A17... 42 0.078
gb|AC140027.11| Medicago truncatula clone mth2-5m21, comple... 42 0.078
gb|AC146703.19| Medicago truncatula clone mth2-22o12, WORKI... 42 0.078
>emb|CR330228.1| mte1-59N8FM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 686
Score = 42.1 bits (21), Expect = 0.078
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 46 ataaagtttgaaatagaggatgaaa 70
||||| |||||||||||||||||||
Sbjct: 142 ataaactttgaaatagaggatgaaa 118
>gb|AC140027.11| Medicago truncatula clone mth2-5m21, complete sequence
Length = 131365
Score = 42.1 bits (21), Expect = 0.078
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 533 tgctatttcagatctgacggt 553
|||||||||||||||||||||
Sbjct: 56623 tgctatttcagatctgacggt 56603
>gb|AC146703.19| Medicago truncatula clone mth2-22o12, WORKING DRAFT SEQUENCE, 25
unordered pieces
Length = 235128
Score = 42.1 bits (21), Expect = 0.078
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 533 tgctatttcagatctgacggt 553
|||||||||||||||||||||
Sbjct: 16921 tgctatttcagatctgacggt 16901
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 172,503
Number of Sequences: 392609
Number of extensions: 172503
Number of successful extensions: 12795
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 12786
Number of HSP's gapped (non-prelim): 9
length of query: 880
length of database: 441,732,993
effective HSP length: 20
effective length of query: 860
effective length of database: 433,880,813
effective search space: 373137499180
effective search space used: 373137499180
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)