BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1804918.2.5
(733 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW559489.1|AW559489 EST314537 DSIR Medicago truncatula c... 96 5e-018
gb|BE204037.1|BE204037 EST396713 KV0 Medicago truncatula cD... 96 5e-018
gb|AL370927.1|AL370927 MtBA40G10F1 MtBA Medicago truncatula... 96 5e-018
gb|AL377122.1|AL377122 MtBB29E07F1 MtBB Medicago truncatula... 96 5e-018
gb|AL377449.1|AL377449 MtBB31F10F1 MtBB Medicago truncatula... 96 5e-018
gb|AL387623.1|AL387623 MtBC43G04F1 MtBC Medicago truncatula... 96 5e-018
gb|BE998026.1|BE998026 EST429749 GVSN Medicago truncatula c... 96 5e-018
gb|BF520932.1|BF520932 EST458405 DSIL Medicago truncatula c... 96 5e-018
gb|BE249000.2|BE249000 NF030H10DT1F1089 Drought Medicago tr... 96 5e-018
gb|BG453389.1|BG453389 NF096A12LF1F1086 Developing leaf Med... 96 5e-018
gb|BG456679.1|BG456679 NF083F11PL1F1093 Phosphate starved l... 96 5e-018
gb|BG456965.1|BG456965 NF099G10PL1F1082 Phosphate starved l... 96 5e-018
gb|BG457886.1|BG457886 NF033B02PL1F1013 Phosphate starved l... 96 5e-018
gb|BG646525.1|BG646525 EST508144 HOGA Medicago truncatula c... 96 5e-018
gb|BI264407.1|BI264407 NF113B03PL1F1029 Phosphate starved l... 96 5e-018
gb|BI268933.1|BI268933 NF001F09IR1F1078 Irradiated Medicago... 96 5e-018
gb|AJ504251.1|AJ504251 AJ504251 MTAMP Medicago truncatula c... 96 5e-018
gb|AJ498101.1|AJ498101 AJ498101 MTPOSE Medicago truncatula ... 96 5e-018
gb|CF068308.1|CF068308 EST669029 MTUS Medicago truncatula c... 96 5e-018
gb|CX541874.1|CX541874 s13dNF71H06GS060_467056 Germinating ... 96 5e-018
gb|BG455739.1|BG455739 NF065D05PL1F1044 Phosphate starved l... 94 2e-017
gb|AA660260.1|AA660260 00129 MtRHE Medicago truncatula cDNA... 92 8e-017
gb|AA660605.1|AA660605 00492 MtRHE Medicago truncatula cDNA... 92 8e-017
gb|AJ388826.1|AJ388826 AJ388826 Medicago truncatula R108Mt ... 92 8e-017
gb|AW559382.1|AW559382 EST314430 DSIR Medicago truncatula c... 92 8e-017
gb|BE124634.1|BE124634 EST393669 GVN Medicago truncatula cD... 92 8e-017
gb|AL376608.1|AL376608 MtBB24H12F1 MtBB Medicago truncatula... 92 8e-017
gb|AL376838.1|AL376838 MtBB26F09R1 MtBB Medicago truncatula... 92 8e-017
gb|BF636718.1|BF636718 NF050G01LF1F1005 Developing leaf Med... 92 8e-017
gb|BQ140015.1|BQ140015 NF027G09PH1F1071 Phoma-infected Medi... 92 8e-017
gb|AJ502299.1|AJ502299 AJ502299 MTAMP Medicago truncatula c... 92 8e-017
gb|CA920093.1|CA920093 EST637811 MTUS Medicago truncatula c... 92 8e-017
gb|CF069583.1|CF069583 EST670304 MTUS Medicago truncatula c... 92 8e-017
gb|CX522264.1|CX522264 s13dNF67C11VI084_470332 Virus-Infect... 92 8e-017
gb|CA918999.1|CA918999 EST636717 MTUS Medicago truncatula c... 88 1e-015
gb|CX538503.1|CX538503 s13dNF75B08GS061_460258 Germinating ... 84 2e-014
gb|AW690333.1|AW690333 NF032C03ST1F1000 Developing stem Med... 80 3e-013
gb|AL387624.1|AL387624 MtBC43G04R1 MtBC Medicago truncatula... 80 3e-013
gb|AW774796.1|AW774796 EST333947 KV3 Medicago truncatula cD... 66 4e-009
gb|BF640340.1|BF640340 NF037B04IN1F1032 Insect herbivory Me... 64 2e-008
gb|BE239515.1|BE239515 EST403564 MHRP- Medicago truncatula ... 60 3e-007
gb|AL386864.1|AL386864 MtBC37C12R1 MtBC Medicago truncatula... 56 4e-006
gb|AL377123.1|AL377123 MtBB29E07R1 MtBB Medicago truncatula... 44 0.016
gb|BF648291.1|BF648291 NF046C02EC1F1017 Elicited cell cultu... 44 0.016
>gb|AW559489.1|AW559489 EST314537 DSIR Medicago truncatula cDNA clone pDSIR-19B22, mRNA
sequence
Length = 656
Score = 95.6 bits (48), Expect = 5e-018
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 353 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 294
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 293 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 234
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 233 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 174
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 173 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 130
>gb|BE204037.1|BE204037 EST396713 KV0 Medicago truncatula cDNA clone pKV0-14C20, mRNA
sequence
Length = 500
Score = 95.6 bits (48), Expect = 5e-018
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 318 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 259
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 258 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 199
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 198 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 139
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 138 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 95
>gb|AL370927.1|AL370927 MtBA40G10F1 MtBA Medicago truncatula cDNA clone MtBA40G10 T3, mRNA
sequence
Length = 435
Score = 95.6 bits (48), Expect = 5e-018
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 351 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 292
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 291 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 232
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 231 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 172
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 171 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 128
>gb|AL377122.1|AL377122 MtBB29E07F1 MtBB Medicago truncatula cDNA clone MtBB29E07 T3, mRNA
sequence
Length = 438
Score = 95.6 bits (48), Expect = 5e-018
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 362 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 303
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 302 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 243
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 242 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 183
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 182 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 139
>gb|AL377449.1|AL377449 MtBB31F10F1 MtBB Medicago truncatula cDNA clone MtBB31F10 T3, mRNA
sequence
Length = 393
Score = 95.6 bits (48), Expect = 5e-018
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 351 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 292
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 291 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 232
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 231 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 172
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 171 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 128
>gb|AL387623.1|AL387623 MtBC43G04F1 MtBC Medicago truncatula cDNA clone MtBC43G04 T3, mRNA
sequence
Length = 468
Score = 95.6 bits (48), Expect = 5e-018
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 355 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 296
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 295 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 236
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 235 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 176
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 175 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 132
>gb|BE998026.1|BE998026 EST429749 GVSN Medicago truncatula cDNA clone pGVSN-8J21, mRNA
sequence
Length = 551
Score = 95.6 bits (48), Expect = 5e-018
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 340 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 281
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 280 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 221
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 220 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 161
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 160 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 117
>gb|BF520932.1|BF520932 EST458405 DSIL Medicago truncatula cDNA clone pDSIL-39J12, mRNA
sequence
Length = 697
Score = 95.6 bits (48), Expect = 5e-018
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 364 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 305
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 304 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 245
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 244 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 185
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 184 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 141
>gb|BE249000.2|BE249000 NF030H10DT1F1089 Drought Medicago truncatula cDNA clone NF030H10DT
5', mRNA sequence
Length = 588
Score = 95.6 bits (48), Expect = 5e-018
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 362 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 303
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 302 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 243
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 242 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 183
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 182 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 139
>gb|BG453389.1|BG453389 NF096A12LF1F1086 Developing leaf Medicago truncatula cDNA clone
NF096A12LF 5', mRNA sequence
Length = 670
Score = 95.6 bits (48), Expect = 5e-018
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 352 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 293
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 292 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 233
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 232 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 173
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 172 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 129
>gb|BG456679.1|BG456679 NF083F11PL1F1093 Phosphate starved leaf Medicago truncatula cDNA
clone NF083F11PL 5', mRNA sequence
Length = 677
Score = 95.6 bits (48), Expect = 5e-018
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 351 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 292
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 291 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 232
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 231 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 172
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 171 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 128
>gb|BG456965.1|BG456965 NF099G10PL1F1082 Phosphate starved leaf Medicago truncatula cDNA
clone NF099G10PL 5', mRNA sequence
Length = 676
Score = 95.6 bits (48), Expect = 5e-018
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 349 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 290
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 289 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 230
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 229 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 170
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 169 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 126
>gb|BG457886.1|BG457886 NF033B02PL1F1013 Phosphate starved leaf Medicago truncatula cDNA
clone NF033B02PL 5', mRNA sequence
Length = 679
Score = 95.6 bits (48), Expect = 5e-018
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 360 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 301
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 300 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 241
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 240 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 181
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 180 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 137
>gb|BG646525.1|BG646525 EST508144 HOGA Medicago truncatula cDNA clone pHOGA-9E17 5' end,
mRNA sequence
Length = 685
Score = 95.6 bits (48), Expect = 5e-018
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 353 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 294
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 293 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 234
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 233 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 174
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 173 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 130
>gb|BI264407.1|BI264407 NF113B03PL1F1029 Phosphate starved leaf Medicago truncatula cDNA
clone NF113B03PL 5', mRNA sequence
Length = 661
Score = 95.6 bits (48), Expect = 5e-018
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 363 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 304
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 303 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 244
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 243 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 184
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 183 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 140
>gb|BI268933.1|BI268933 NF001F09IR1F1078 Irradiated Medicago truncatula cDNA clone
NF001F09IR 5', mRNA sequence
Length = 564
Score = 95.6 bits (48), Expect = 5e-018
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 364 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 305
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 304 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 245
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 244 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 185
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 184 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 141
>gb|AJ504251.1|AJ504251 AJ504251 MTAMP Medicago truncatula cDNA clone mtgmadc120045c12,
mRNA sequence
Length = 587
Score = 95.6 bits (48), Expect = 5e-018
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 382 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 323
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 322 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 263
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 262 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 203
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 202 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 159
>gb|AJ498101.1|AJ498101 AJ498101 MTPOSE Medicago truncatula cDNA clone mt--acc955201b01,
mRNA sequence
Length = 627
Score = 95.6 bits (48), Expect = 5e-018
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 394 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 335
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 334 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 275
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 274 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 215
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 214 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 171
>gb|CF068308.1|CF068308 EST669029 MTUS Medicago truncatula cDNA clone MTUS-6D3, mRNA
sequence
Length = 679
Score = 95.6 bits (48), Expect = 5e-018
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 349 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 290
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 289 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 230
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 229 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 170
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 169 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 126
>gb|CX541874.1|CX541874 s13dNF71H06GS060_467056 Germinating Seed Medicago truncatula cDNA,
mRNA sequence
Length = 590
Score = 95.6 bits (48), Expect = 5e-018
Identities = 180/224 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 361 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 302
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 301 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 242
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 241 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 182
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 181 ttctttggtgagagaccgagaggaccgatcttgggagcgaggga 138
>gb|BG455739.1|BG455739 NF065D05PL1F1044 Phosphate starved leaf Medicago truncatula cDNA
clone NF065D05PL 5', mRNA sequence
Length = 610
Score = 93.7 bits (47), Expect = 2e-017
Identities = 173/215 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 361 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 302
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 301 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 242
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 241 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 182
Query: 599 ttcttcggggagagcccgagcgggccgatcttggg 633
||||| || ||||| ||||| || |||||||||||
Sbjct: 181 ttctttggtgagagaccgagaggaccgatcttggg 147
>gb|AA660260.1|AA660260 00129 MtRHE Medicago truncatula cDNA 5' similar to 60S ribosomal
protein L12, mRNA sequence
Length = 587
Score = 91.7 bits (46), Expect = 8e-017
Identities = 103/122 (84%)
Strand = Plus / Minus
Query: 521 ttctggacggtgagcttgacggtgacgcgcaggcccttccagtccttggccgtctccttg 580
|||||||||||||||||||| ||||| || || ||||||||||| || || || || |||
Sbjct: 255 ttctggacggtgagcttgactgtgacacggagacccttccagtcttttgcggtttctttg 196
Query: 581 gcgatgtcctcgccgatcttcttcggggagagcccgagcgggccgatcttgggcgccagg 640
|||||||| || |||||||| || || ||||| ||||| || ||||||||||| || |||
Sbjct: 195 gcgatgtcttctccgatcttttttggagagagaccgagtggtccgatcttgggagcgagg 136
Query: 641 ga 642
||
Sbjct: 135 ga 134
>gb|AA660605.1|AA660605 00492 MtRHE Medicago truncatula cDNA 5' similar to 60S ribosomal
protein L12, mRNA sequence
Length = 572
Score = 91.7 bits (46), Expect = 8e-017
Identities = 115/138 (83%)
Strand = Plus / Minus
Query: 505 gaccttggcctggcggttctggacggtgagcttgacggtgacgcgcaggcccttccagtc 564
|||||| ||||| || ||||| |||||||||||||| || || | ||| |||||||| ||
Sbjct: 271 gaccttagcctgacgattctgaacggtgagcttgactgtcaccctcagacccttccaatc 212
Query: 565 cttggccgtctccttggcgatgtcctcgccgatcttcttcggggagagcccgagcgggcc 624
||| || || || ||||||||||| || ||||||||||| || ||||| ||||| || ||
Sbjct: 211 ctttgcggtttctttggcgatgtcttctccgatcttctttggtgagagaccgagaggacc 152
Query: 625 gatcttgggcgccaggga 642
||||||||| || |||||
Sbjct: 151 gatcttgggagcgaggga 134
>gb|AJ388826.1|AJ388826 AJ388826 Medicago truncatula R108Mt Medicago truncatula cDNA clone
MtNo192 similar to 60S ribosomal protein L12, mRNA
sequence
Length = 530
Score = 91.7 bits (46), Expect = 8e-017
Identities = 115/138 (83%)
Strand = Plus / Minus
Query: 505 gaccttggcctggcggttctggacggtgagcttgacggtgacgcgcaggcccttccagtc 564
|||||| ||||| || ||||| |||||||||||||| || || | ||| |||||||| ||
Sbjct: 262 gaccttagcctgacgattctgaacggtgagcttgactgtcaccctcagacccttccaatc 203
Query: 565 cttggccgtctccttggcgatgtcctcgccgatcttcttcggggagagcccgagcgggcc 624
||| || || || ||||||||||| || ||||||||||| || ||||| ||||| || ||
Sbjct: 202 ctttgcggtttctttggcgatgtcttctccgatcttctttggtgagagaccgagaggacc 143
Query: 625 gatcttgggcgccaggga 642
||||||||| || |||||
Sbjct: 142 gatcttgggagcgaggga 125
>gb|AW559382.1|AW559382 EST314430 DSIR Medicago truncatula cDNA clone pDSIR-7L9, mRNA
sequence
Length = 653
Score = 91.7 bits (46), Expect = 8e-017
Identities = 103/122 (84%)
Strand = Plus / Minus
Query: 521 ttctggacggtgagcttgacggtgacgcgcaggcccttccagtccttggccgtctccttg 580
|||||||||||||||||||| ||||| || || ||||||||||| || || || || |||
Sbjct: 221 ttctggacggtgagcttgactgtgacacggagacccttccagtcttttgcggtttctttg 162
Query: 581 gcgatgtcctcgccgatcttcttcggggagagcccgagcgggccgatcttgggcgccagg 640
|||||||| || |||||||| || || ||||| ||||| || ||||||||||| || |||
Sbjct: 161 gcgatgtcttctccgatcttttttggagagagaccgagtggtccgatcttgggagcgagg 102
Query: 641 ga 642
||
Sbjct: 101 ga 100
>gb|BE124634.1|BE124634 EST393669 GVN Medicago truncatula cDNA clone pGVN-67K13, mRNA
sequence
Length = 558
Score = 91.7 bits (46), Expect = 8e-017
Identities = 103/122 (84%)
Strand = Plus / Minus
Query: 521 ttctggacggtgagcttgacggtgacgcgcaggcccttccagtccttggccgtctccttg 580
|||||||||||||||||||| ||||| || || ||||||||||| || || || || |||
Sbjct: 254 ttctggacggtgagcttgactgtgacacggagacccttccagtcttttgcggtttctttg 195
Query: 581 gcgatgtcctcgccgatcttcttcggggagagcccgagcgggccgatcttgggcgccagg 640
|||||||| || |||||||| || || ||||| ||||| || ||||||||||| || |||
Sbjct: 194 gcgatgtcttctccgatcttttttggagagagaccgagtggtccgatcttgggagcgagg 135
Query: 641 ga 642
||
Sbjct: 134 ga 133
>gb|AL376608.1|AL376608 MtBB24H12F1 MtBB Medicago truncatula cDNA clone MtBB24H12 T3, mRNA
sequence
Length = 373
Score = 91.7 bits (46), Expect = 8e-017
Identities = 103/122 (84%)
Strand = Plus / Minus
Query: 521 ttctggacggtgagcttgacggtgacgcgcaggcccttccagtccttggccgtctccttg 580
|||||||||||||||||||| ||||| || || ||||||||||| || || || || |||
Sbjct: 260 ttctggacggtgagcttgactgtgacacggagacccttccagtcttttgcggtttctttg 201
Query: 581 gcgatgtcctcgccgatcttcttcggggagagcccgagcgggccgatcttgggcgccagg 640
|||||||| || |||||||| || || ||||| ||||| || ||||||||||| || |||
Sbjct: 200 gcgatgtcttctccgatcttttttggagagagaccgagtggtccgatcttgggagcgagg 141
Query: 641 ga 642
||
Sbjct: 140 ga 139
>gb|AL376838.1|AL376838 MtBB26F09R1 MtBB Medicago truncatula cDNA clone MtBB26F09 T7, mRNA
sequence
Length = 449
Score = 91.7 bits (46), Expect = 8e-017
Identities = 103/122 (84%)
Strand = Plus / Plus
Query: 521 ttctggacggtgagcttgacggtgacgcgcaggcccttccagtccttggccgtctccttg 580
|||||||||||||||||||| ||||| || || ||||||||||| || || || || |||
Sbjct: 148 ttctggacggtgagcttgactgtgacacggagacccttccagtcttttgcggtttctttg 207
Query: 581 gcgatgtcctcgccgatcttcttcggggagagcccgagcgggccgatcttgggcgccagg 640
|||||||| || |||||||| || || ||||| ||||| || ||||||||||| || |||
Sbjct: 208 gcgatgtcttctccgatcttttttggagagagaccgagtggtccgatcttgggagcgagg 267
Query: 641 ga 642
||
Sbjct: 268 ga 269
>gb|BF636718.1|BF636718 NF050G01LF1F1005 Developing leaf Medicago truncatula cDNA clone
NF050G01LF 5', mRNA sequence
Length = 631
Score = 91.7 bits (46), Expect = 8e-017
Identities = 103/122 (84%)
Strand = Plus / Minus
Query: 521 ttctggacggtgagcttgacggtgacgcgcaggcccttccagtccttggccgtctccttg 580
|||||||||||||||||||| ||||| || || ||||||||||| || || || || |||
Sbjct: 260 ttctggacggtgagcttgactgtgacacggagacccttccagtcttttgcggtttctttg 201
Query: 581 gcgatgtcctcgccgatcttcttcggggagagcccgagcgggccgatcttgggcgccagg 640
|||||||| || |||||||| || || ||||| ||||| || ||||||||||| || |||
Sbjct: 200 gcgatgtcttctccgatcttttttggagagagaccgagtggtccgatcttgggagcgagg 141
Query: 641 ga 642
||
Sbjct: 140 ga 139
>gb|BQ140015.1|BQ140015 NF027G09PH1F1071 Phoma-infected Medicago truncatula cDNA clone
NF027G09PH 5', mRNA sequence
Length = 483
Score = 91.7 bits (46), Expect = 8e-017
Identities = 179/224 (79%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 359 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 300
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | | |||| ||||| || ||||| ||||||||||||
Sbjct: 299 agcgcagccgcagacggaacaacagcgnccttagcctgacgattctgaacggtgagcttg 240
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 239 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 180
Query: 599 ttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 179 ttctttggtgagagaccgagaggnccgatcttgggagcgaggga 136
>gb|AJ502299.1|AJ502299 AJ502299 MTAMP Medicago truncatula cDNA clone mtgmadc120019a11,
mRNA sequence
Length = 363
Score = 91.7 bits (46), Expect = 8e-017
Identities = 115/138 (83%)
Strand = Plus / Minus
Query: 505 gaccttggcctggcggttctggacggtgagcttgacggtgacgcgcaggcccttccagtc 564
|||||| ||||| || ||||| |||||||||||||| || || | ||| |||||||| ||
Sbjct: 299 gaccttagcctgacgattctgaacggtgagcttgactgtcaccctcagacccttccaatc 240
Query: 565 cttggccgtctccttggcgatgtcctcgccgatcttcttcggggagagcccgagcgggcc 624
||| || || || ||||||||||| || ||||||||||| || ||||| ||||| || ||
Sbjct: 239 ctttgcggtttctttggcgatgtcttctccgatcttctttggtgagagaccgagaggacc 180
Query: 625 gatcttgggcgccaggga 642
||||||||| || |||||
Sbjct: 179 gatcttgggagcgaggga 162
>gb|CA920093.1|CA920093 EST637811 MTUS Medicago truncatula cDNA clone MTUS-22A10, mRNA
sequence
Length = 647
Score = 91.7 bits (46), Expect = 8e-017
Identities = 103/122 (84%)
Strand = Plus / Plus
Query: 521 ttctggacggtgagcttgacggtgacgcgcaggcccttccagtccttggccgtctccttg 580
|||||||||||||||||||| ||||| || || ||||||||||| || || || || |||
Sbjct: 410 ttctggacggtgagcttgactgtgacacggagacccttccagtcttttgcggtttctttg 469
Query: 581 gcgatgtcctcgccgatcttcttcggggagagcccgagcgggccgatcttgggcgccagg 640
|||||||| || |||||||| || || ||||| ||||| || ||||||||||| || |||
Sbjct: 470 gcgatgtcttctccgatcttttttggagagagaccgagtggtccgatcttgggagcgagg 529
Query: 641 ga 642
||
Sbjct: 530 ga 531
>gb|CF069583.1|CF069583 EST670304 MTUS Medicago truncatula cDNA clone MTUS-22A10, mRNA
sequence
Length = 674
Score = 91.7 bits (46), Expect = 8e-017
Identities = 103/122 (84%)
Strand = Plus / Minus
Query: 521 ttctggacggtgagcttgacggtgacgcgcaggcccttccagtccttggccgtctccttg 580
|||||||||||||||||||| ||||| || || ||||||||||| || || || || |||
Sbjct: 219 ttctggacggtgagcttgactgtgacacggagacccttccagtcttttgcggtttctttg 160
Query: 581 gcgatgtcctcgccgatcttcttcggggagagcccgagcgggccgatcttgggcgccagg 640
|||||||| || |||||||| || || ||||| ||||| || ||||||||||| || |||
Sbjct: 159 gcgatgtcttctccgatcttttttggagagagaccgagtggtccgatcttgggagcgagg 100
Query: 641 ga 642
||
Sbjct: 99 ga 98
>gb|CX522264.1|CX522264 s13dNF67C11VI084_470332 Virus-Infected Leaves Medicago truncatula
cDNA, mRNA sequence
Length = 535
Score = 91.7 bits (46), Expect = 8e-017
Identities = 103/122 (84%)
Strand = Plus / Minus
Query: 521 ttctggacggtgagcttgacggtgacgcgcaggcccttccagtccttggccgtctccttg 580
|||||||||||||||||||| ||||| || || ||||||||||| || || || || |||
Sbjct: 251 ttctggacggtgagcttgactgtgacacggagacccttccagtcttttgcggtttctttg 192
Query: 581 gcgatgtcctcgccgatcttcttcggggagagcccgagcgggccgatcttgggcgccagg 640
|||||||| || |||||||| || || ||||| ||||| || ||||||||||| || |||
Sbjct: 191 gcgatgtcttctccgatcttttttggagagagaccgagtggtccgatcttgggagcgagg 132
Query: 641 ga 642
||
Sbjct: 131 ga 130
>gb|CA918999.1|CA918999 EST636717 MTUS Medicago truncatula cDNA clone MTUS-6D3, mRNA
sequence
Length = 603
Score = 87.7 bits (44), Expect = 1e-015
Identities = 170/212 (80%)
Strand = Plus / Plus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 333 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 392
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 393 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 452
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 453 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 512
Query: 599 ttcttcggggagagcccgagcgggccgatctt 630
||||| || ||||| ||||| || ||||||||
Sbjct: 513 ttctttggtgagagaccgagaggaccgatctt 544
>gb|CX538503.1|CX538503 s13dNF75B08GS061_460258 Germinating Seed Medicago truncatula cDNA,
mRNA sequence
Length = 490
Score = 83.8 bits (42), Expect = 2e-014
Identities = 168/210 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 211 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 152
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 151 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 92
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 91 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 32
Query: 599 ttcttcggggagagcccgagcgggccgatc 628
||||| || ||||| ||||| || ||||||
Sbjct: 31 ttctttggtgagagaccgagaggaccgatc 2
>gb|AW690333.1|AW690333 NF032C03ST1F1000 Developing stem Medicago truncatula cDNA clone
NF032C03ST 5', mRNA sequence
Length = 253
Score = 79.8 bits (40), Expect = 3e-013
Identities = 97/116 (83%)
Strand = Plus / Minus
Query: 527 acggtgagcttgacggtgacgcgcaggcccttccagtccttggccgtctccttggcgatg 586
|||||||||||||| || || | ||| |||||||| ||||| || || || |||||||||
Sbjct: 253 acggtgagcttgactgtcaccctcagacccttccaatcctttgcggtttctttggcgatg 194
Query: 587 tcctcgccgatcttcttcggggagagcccgagcgggccgatcttgggcgccaggga 642
|| || ||||||||||| || ||||| ||||| || ||||||||||| || |||||
Sbjct: 193 tcttctccgatcttctttggtgagagaccgagaggaccgatcttgggagcgaggga 138
>gb|AL387624.1|AL387624 MtBC43G04R1 MtBC Medicago truncatula cDNA clone MtBC43G04 T7, mRNA
sequence
Length = 535
Score = 79.8 bits (40), Expect = 3e-013
Identities = 160/200 (80%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 206 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 147
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 146 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 87
Query: 539 acggtgacgcgcaggcccttccagtccttggccgtctccttggcgatgtcctcgccgatc 598
|| || || | ||| |||||||| ||||| || || || ||||||||||| || ||||||
Sbjct: 86 actgtcaccctcagacccttccaatcctttgcggtttctttggcgatgtcttctccgatc 27
Query: 599 ttcttcggggagagcccgag 618
||||| || ||||| |||||
Sbjct: 26 ttctttggtgagagaccgag 7
>gb|AW774796.1|AW774796 EST333947 KV3 Medicago truncatula cDNA clone pKV3-24A1, mRNA
sequence
Length = 388
Score = 65.9 bits (33), Expect = 4e-009
Identities = 102/125 (81%)
Strand = Plus / Minus
Query: 505 gaccttggcctggcggttctggacggtgagcttgacggtgacgcgcaggcccttccagtc 564
|||||| ||||| || ||||| |||||||||||||| || || | ||| |||||||| ||
Sbjct: 184 gaccttagcctgacgattctgaacggtgagcttgactgtcaccctcagacccttccaatc 125
Query: 565 cttggccgtctccttggcgatgtcctcgccgatcttcttcggggagagcccgagcgggcc 624
||| || || || ||||||| ||| || ||||||| ||| || |||| |||||| || ||
Sbjct: 124 ctttgcggtttctttggcgaagtcttctccgatctcctttggtgagaccccgagaggacc 65
Query: 625 gatct 629
|||||
Sbjct: 64 gatct 60
>gb|BF640340.1|BF640340 NF037B04IN1F1032 Insect herbivory Medicago truncatula cDNA clone
NF037B04IN 5', mRNA sequence
Length = 256
Score = 63.9 bits (32), Expect = 2e-008
Identities = 59/68 (86%)
Strand = Plus / Minus
Query: 521 ttctggacggtgagcttgacggtgacgcgcaggcccttccagtccttggccgtctccttg 580
|||||||||||||||||||| ||||| || || ||||||||||| || || || || |||
Sbjct: 75 ttctggacggtgagcttgactgtgacacggagacccttccagtcttttgcggtttctttg 16
Query: 581 gcgatgtc 588
||||||||
Sbjct: 15 gcgatgtc 8
>gb|BE239515.1|BE239515 EST403564 MHRP- Medicago truncatula cDNA clone pMHRP-28M14, mRNA
sequence
Length = 620
Score = 60.0 bits (30), Expect = 3e-007
Identities = 99/122 (81%)
Strand = Plus / Minus
Query: 521 ttctggacggtgagcttgacggtgacgcgcaggcccttccagtccttggccgtctccttg 580
|||||| ||||||||||||| ||||| || || ||||||||||| || || || || |||
Sbjct: 180 ttctgggcggtgagcttgactgtgacacggagacccttccagtcttttgcggtttctttg 121
Query: 581 gcgatgtcctcgccgatcttcttcggggagagcccgagcgggccgatcttgggcgccagg 640
|||||||| || ||| |||| || | ||||| |||| || ||||||||||| || |||
Sbjct: 120 gcgatgtcttctccgctcttttttgaagagagaccgactggtccgatcttgggagcgagg 61
Query: 641 ga 642
||
Sbjct: 60 ga 59
>gb|AL386864.1|AL386864 MtBC37C12R1 MtBC Medicago truncatula cDNA clone MtBC37C12 T7, mRNA
sequence
Length = 498
Score = 56.0 bits (28), Expect = 4e-006
Identities = 40/44 (90%)
Strand = Plus / Minus
Query: 521 ttctggacggtgagcttgacggtgacgcgcaggcccttccagtc 564
|||||||||||||||||||| ||||| || || |||||||||||
Sbjct: 50 ttctggacggtgagcttgactgtgacacggagacccttccagtc 7
>gb|AL377123.1|AL377123 MtBB29E07R1 MtBB Medicago truncatula cDNA clone MtBB29E07 T7, mRNA
sequence
Length = 486
Score = 44.1 bits (22), Expect = 0.016
Identities = 97/122 (79%)
Strand = Plus / Minus
Query: 419 tgcttgatgttcttgaccttcttccggtccctctcgggctccttgagcgccttgatgacg 478
|||||||||||||| |||||| || ||||| || || ||||| | |||||||| ||
Sbjct: 142 tgcttgatgttcttagtcttcttgcgatccctttctggttccttcaaagccttgataacc 83
Query: 479 agcgcggcggcggaggggacgacggagaccttggcctggcggttctggacggtgagcttg 538
||||| || || || || || || | |||||| ||||| || ||||| ||||||||||||
Sbjct: 82 agcgcagccgcagacggaacaacagcgaccttagcctgacgattctgaacggtgagcttg 23
Query: 539 ac 540
||
Sbjct: 22 ac 21
>gb|BF648291.1|BF648291 NF046C02EC1F1017 Elicited cell culture Medicago truncatula cDNA
clone NF046C02EC 5', mRNA sequence
Length = 472
Score = 44.1 bits (22), Expect = 0.016
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 521 ttctggacggtgagcttgacggtgac 546
|||||||||||||||||||| |||||
Sbjct: 126 ttctggacggtgagcttgactgtgac 101
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 103,195
Number of Sequences: 392609
Number of extensions: 103195
Number of successful extensions: 9885
Number of sequences better than 0.5: 44
Number of HSP's better than 0.5 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 9791
Number of HSP's gapped (non-prelim): 69
length of query: 733
length of database: 441,732,993
effective HSP length: 19
effective length of query: 714
effective length of database: 434,273,422
effective search space: 310071223308
effective search space used: 310071223308
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)