BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1804898.2.1
(739 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AC144476.11| Medicago truncatula clone mth2-10a6, comple... 40 0.26
gb|AC147431.19| Medicago truncatula clone mth2-88g17, compl... 40 0.26
gb|AC174147.6| Medicago truncatula clone mth2-75g18, WORKIN... 40 0.26
>gb|AC144476.11| Medicago truncatula clone mth2-10a6, complete sequence
Length = 119355
Score = 40.1 bits (20), Expect = 0.26
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 189 acgactgggatgaggacaagtgca 212
||||| ||||||||||||||||||
Sbjct: 81081 acgacagggatgaggacaagtgca 81058
>gb|AC147431.19| Medicago truncatula clone mth2-88g17, complete sequence
Length = 145905
Score = 40.1 bits (20), Expect = 0.26
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 189 acgactgggatgaggacaagtgca 212
||||| ||||||||||||||||||
Sbjct: 60956 acgacagggatgaggacaagtgca 60933
>gb|AC174147.6| Medicago truncatula clone mth2-75g18, WORKING DRAFT SEQUENCE
Length = 128741
Score = 40.1 bits (20), Expect = 0.26
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 189 acgactgggatgaggacaagtgca 212
||||| ||||||||||||||||||
Sbjct: 121642 acgacagggatgaggacaagtgca 121619
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 130,914
Number of Sequences: 392609
Number of extensions: 130914
Number of successful extensions: 9715
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 9706
Number of HSP's gapped (non-prelim): 9
length of query: 739
length of database: 441,732,993
effective HSP length: 19
effective length of query: 720
effective length of database: 434,273,422
effective search space: 312676863840
effective search space used: 312676863840
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)