BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 1716296.2.7
(851 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AL373908.1|AL373908 MtBB03E08F1 MtBB Medicago truncatula... 62 8e-008
gb|BF637655.1|BF637655 NF032B07PL1F1059 Phosphate starved l... 62 8e-008
gb|CX524368.1|CX524368 s13dNF15A03AT017_448080 Aphid-Infect... 62 8e-008
gb|DW017022.1|DW017022 EST1225983 MTY Medicago truncatula c... 62 8e-008
gb|AC134242.17| Medicago truncatula clone mth2-10p20, compl... 62 8e-008
gb|BE187600.1|BE187600 EST336161 KV0 Medicago truncatula cD... 58 1e-006
gb|AJ388692.1|AJ388692 AJ388692 Medicago truncatula R108 Me... 50 3e-004
gb|AW267758.1|AW267758 EST305886 DSIR Medicago truncatula c... 50 3e-004
gb|AW559786.1|AW559786 EST314834 DSIR Medicago truncatula c... 50 3e-004
gb|AW775786.1|AW775786 EST334851 DSIL Medicago truncatula c... 50 3e-004
gb|BE203378.1|BE203378 EST403400 KV1 Medicago truncatula cD... 50 3e-004
gb|AL365942.1|AL365942 MtBA03C11F2 MtBA Medicago truncatula... 50 3e-004
gb|AL368756.1|AL368756 MtBA26E07F1 MtBA Medicago truncatula... 50 3e-004
gb|AL368801.1|AL368801 MtBA26H04F1 MtBA Medicago truncatula... 50 3e-004
gb|AL370487.1|AL370487 MtBA38B04F1 MtBA Medicago truncatula... 50 3e-004
gb|AL371197.1|AL371197 MtBA42E06F1 MtBA Medicago truncatula... 50 3e-004
gb|AL374421.1|AL374421 MtBB06E05F1 MtBB Medicago truncatula... 50 3e-004
gb|AL375736.1|AL375736 MtBB16F12F1 MtBB Medicago truncatula... 50 3e-004
gb|AL377345.1|AL377345 MtBB30H09F1 MtBB Medicago truncatula... 50 3e-004
gb|AL378912.1|AL378912 MtBB41C05F1 MtBB Medicago truncatula... 50 3e-004
gb|BF520355.1|BF520355 EST457825 DSIL Medicago truncatula c... 50 3e-004
gb|BF521377.1|BF521377 EST458853 DSIL Medicago truncatula c... 50 3e-004
gb|BF637060.1|BF637060 NF050A11LF1F1082 Developing leaf Med... 50 3e-004
gb|BF638341.1|BF638341 NF054H06PL1F1058 Phosphate starved l... 50 3e-004
gb|BF646591.1|BF646591 NF078E02EC1F1018 Elicited cell cultu... 50 3e-004
gb|AW686242.2|AW686242 NF039F07NR1F1000 Nodulated root Medi... 50 3e-004
gb|AW692987.2|AW692987 NF061F09ST1F1000 Developing stem Med... 50 3e-004
gb|BE315863.2|BE315863 NF027C03LF1F1018 Developing leaf Med... 50 3e-004
gb|BE317627.2|BE317627 NF054C12LF1F1086 Developing leaf Med... 50 3e-004
gb|BE316289.2|BE316289 NF032C01LF1F1002 Developing leaf Med... 50 3e-004
gb|BE318077.2|BE318077 NF062C09LF1F1066 Developing leaf Med... 50 3e-004
gb|BE318120.2|BE318120 NF062G11LF1F1084 Developing leaf Med... 50 3e-004
gb|BG448975.1|BG448975 NF003H12IN1F1104 Insect herbivory Me... 50 3e-004
gb|BG581855.1|BG581855 EST483591 GVN Medicago truncatula cD... 50 3e-004
gb|BI263903.1|BI263903 NF092C05PL1F1038 Phosphate starved l... 50 3e-004
gb|BI309824.1|BI309824 EST5311574 GESD Medicago truncatula ... 50 3e-004
gb|BQ139506.1|BQ139506 NF021A04PH1F1024 Phoma-infected Medi... 50 3e-004
gb|AJ502053.1|AJ502053 AJ502053 MTAMP Medicago truncatula c... 50 3e-004
gb|CA919363.1|CA919363 EST637081 MTUS Medicago truncatula c... 50 3e-004
gb|CA921752.1|CA921752 EST639470 MTUS Medicago truncatula c... 50 3e-004
gb|CF068801.1|CF068801 EST669522 MTUS Medicago truncatula c... 50 3e-004
gb|AJ846513.1|AJ846513 AJ846513 MtSCF Medicago truncatula c... 50 3e-004
gb|AJ847287.1|AJ847287 AJ847287 MtSTW Medicago truncatula c... 50 3e-004
gb|CX524027.1|CX524027 s13dNF12G08AT056_447398 Aphid-Infect... 50 3e-004
gb|CX525585.1|CX525585 s13dNF24G05AT040_479804 Aphid-Infect... 50 3e-004
gb|CX525951.1|CX525951 s13dNF32F09AT079_509646 Aphid-Infect... 50 3e-004
gb|CX526843.1|CX526843 s13dNF27C03AT022_514198 Aphid-Infect... 50 3e-004
gb|CX528345.1|CX528345 s13dNF54D07AT062_517202 Aphid-Infect... 50 3e-004
gb|CX532721.1|CX532721 s13dNF48A10MJ069_271725 Methyl Jasmo... 50 3e-004
gb|CX534484.1|CX534484 s13dNF76F08MJ063_328564 Methyl Jasmo... 50 3e-004
gb|CX539416.1|CX539416 s13dNF70G01GS004_462092 Germinating ... 50 3e-004
gb|CX540470.1|CX540470 s13dNF49F08GS063_464216 Germinating ... 50 3e-004
gb|CX540751.1|CX540751 s13dNF56D06GS058_464780 Germinating ... 50 3e-004
gb|BG447738.1|BG447738 NF093D12EC1F1102 Elicited cell cultu... 48 0.001
gb|AJ847011.1|AJ847011 AJ847011 MtSTW Medicago truncatula c... 48 0.001
gb|BE318585.2|BE318585 NF041F04LF1F1032 Developing leaf Med... 42 0.075
gb|AA660717.1|AA660717 00608 MtRHE Medicago truncatula cDNA... 40 0.30
gb|AJ848597.1|AJ848597 AJ848597 MtSN4 Medicago truncatula c... 40 0.30
>gb|AL373908.1|AL373908 MtBB03E08F1 MtBB Medicago truncatula cDNA clone MtBB03E08 T3, mRNA
sequence
Length = 327
Score = 61.9 bits (31), Expect = 8e-008
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 130 ctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||| |||||||||||||||||||| || ||||| |||||||||
Sbjct: 6 ctgatgttgagtaccgttgcttcgtcggaggtcttgcatgggccacc 52
>gb|BF637655.1|BF637655 NF032B07PL1F1059 Phosphate starved leaf Medicago truncatula cDNA
clone NF032B07PL 5', mRNA sequence
Length = 432
Score = 61.9 bits (31), Expect = 8e-008
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 130 ctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||| |||||||||||||||||||| || ||||| |||||||||
Sbjct: 40 ctgatgttgagtaccgttgcttcgtcggaggtcttgcatgggccacc 86
>gb|CX524368.1|CX524368 s13dNF15A03AT017_448080 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 415
Score = 61.9 bits (31), Expect = 8e-008
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 130 ctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||| |||||||||||||||||||| || ||||| |||||||||
Sbjct: 49 ctgatgttgagtaccgttgcttcgtcggaggtcttgcatgggccacc 95
>gb|DW017022.1|DW017022 EST1225983 MTY Medicago truncatula cDNA clone MTYAO52, mRNA
sequence
Length = 792
Score = 61.9 bits (31), Expect = 8e-008
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 130 ctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||| |||||||||||||||||||| || ||||| |||||||||
Sbjct: 71 ctgatgttgagtaccgttgcttcgtcggaggtcttgcatgggccacc 117
>gb|AC134242.17| Medicago truncatula clone mth2-10p20, complete sequence
Length = 115005
Score = 61.9 bits (31), Expect = 8e-008
Identities = 43/47 (91%)
Strand = Plus / Plus
Query: 130 ctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||| |||||||||||||||||||| || ||||| |||||||||
Sbjct: 57852 ctgatgttgagtaccgttgcttcgtcggaggtcttgcatgggccacc 57898
Score = 50.1 bits (25), Expect = 3e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 132 gatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||| || ||||||||||||||||| || ||||| |||||||||
Sbjct: 75087 gatgttgaataccgttgcttcgtcggaggtcttgcatgggccacc 75131
Score = 50.1 bits (25), Expect = 3e-004
Identities = 88/109 (80%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccaccagcaacgagtc 187
||||||||| || ||||| ||||||||||| || ||||| ||||||||| |||||| |
Sbjct: 30782 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccaccgacaacgaagc 30841
Query: 188 gctggagaatgccttcgcctcctacggcgagatcctcgactccaaggtc 236
|| ||||| |||||| | |||||||||||| | || |||||||||
Sbjct: 30842 tctcgagaaagccttctctcaatacggcgagatcgttgattccaaggtc 30890
>gb|BE187600.1|BE187600 EST336161 KV0 Medicago truncatula cDNA clone pKV0-16E11, mRNA
sequence
Length = 499
Score = 58.0 bits (29), Expect = 1e-006
Identities = 50/57 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccaccagcaacga 184
||||||||| || ||||| ||||||||||| || ||||| ||||||||| |||||||
Sbjct: 20 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccaccggcaacga 76
>gb|AJ388692.1|AJ388692 AJ388692 Medicago truncatula R108 Medicago truncatula cDNA clone
MtNo051 similar to glycine-rich RNA binding protein,
mRNA sequence
Length = 503
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 53 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 101
>gb|AW267758.1|AW267758 EST305886 DSIR Medicago truncatula cDNA clone pDSIR-7O5, mRNA
sequence
Length = 375
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 46 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 94
>gb|AW559786.1|AW559786 EST314834 DSIR Medicago truncatula cDNA clone pDSIR-24B2, mRNA
sequence
Length = 331
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 62 ggctgatgttgattaccggtgcttcgtcggaggtcttgcatgggccacc 110
>gb|AW775786.1|AW775786 EST334851 DSIL Medicago truncatula cDNA clone pDSIL-3K7, mRNA
sequence
Length = 606
Score = 50.1 bits (25), Expect = 3e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 132 gatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||| || ||||||||||||||||| || ||||| |||||||||
Sbjct: 19 gatgttgaataccgttgcttcgtcggaggtcttgcatgggccacc 63
>gb|BE203378.1|BE203378 EST403400 KV1 Medicago truncatula cDNA clone pKV1-5G8, mRNA
sequence
Length = 397
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 40 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 88
>gb|AL365942.1|AL365942 MtBA03C11F2 MtBA Medicago truncatula cDNA clone MtBA03C11 T3, mRNA
sequence
Length = 341
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 46 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 94
>gb|AL368756.1|AL368756 MtBA26E07F1 MtBA Medicago truncatula cDNA clone MtBA26E07 T3, mRNA
sequence
Length = 372
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 55 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 103
>gb|AL368801.1|AL368801 MtBA26H04F1 MtBA Medicago truncatula cDNA clone MtBA26H04 T3, mRNA
sequence
Length = 316
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 45 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 93
>gb|AL370487.1|AL370487 MtBA38B04F1 MtBA Medicago truncatula cDNA clone MtBA38B04 T3, mRNA
sequence
Length = 302
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 30 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 78
>gb|AL371197.1|AL371197 MtBA42E06F1 MtBA Medicago truncatula cDNA clone MtBA42E06 T3, mRNA
sequence
Length = 464
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 45 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 93
>gb|AL374421.1|AL374421 MtBB06E05F1 MtBB Medicago truncatula cDNA clone MtBB06E05 T3, mRNA
sequence
Length = 310
Score = 50.1 bits (25), Expect = 3e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 132 gatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||| || ||||||||||||||||| || ||||| |||||||||
Sbjct: 5 gatgttgaataccgttgcttcgtcggaggtcttgcatgggccacc 49
>gb|AL375736.1|AL375736 MtBB16F12F1 MtBB Medicago truncatula cDNA clone MtBB16F12 T3, mRNA
sequence
Length = 291
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 29 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 77
>gb|AL377345.1|AL377345 MtBB30H09F1 MtBB Medicago truncatula cDNA clone MtBB30H09 T3, mRNA
sequence
Length = 334
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 43 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 91
>gb|AL378912.1|AL378912 MtBB41C05F1 MtBB Medicago truncatula cDNA clone MtBB41C05 T3, mRNA
sequence
Length = 245
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 29 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 77
>gb|BF520355.1|BF520355 EST457825 DSIL Medicago truncatula cDNA clone pDSIL-23K4, mRNA
sequence
Length = 364
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 35 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 83
>gb|BF521377.1|BF521377 EST458853 DSIL Medicago truncatula cDNA clone pDSIL-43O21, mRNA
sequence
Length = 409
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 34 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 82
>gb|BF637060.1|BF637060 NF050A11LF1F1082 Developing leaf Medicago truncatula cDNA clone
NF050A11LF 5', mRNA sequence
Length = 418
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 61 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 109
>gb|BF638341.1|BF638341 NF054H06PL1F1058 Phosphate starved leaf Medicago truncatula cDNA
clone NF054H06PL 5', mRNA sequence
Length = 445
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 59 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 107
>gb|BF646591.1|BF646591 NF078E02EC1F1018 Elicited cell culture Medicago truncatula cDNA
clone NF078E02EC 5', mRNA sequence
Length = 380
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 53 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 101
>gb|AW686242.2|AW686242 NF039F07NR1F1000 Nodulated root Medicago truncatula cDNA clone
NF039F07NR 5', mRNA sequence
Length = 416
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 54 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 102
>gb|AW692987.2|AW692987 NF061F09ST1F1000 Developing stem Medicago truncatula cDNA clone
NF061F09ST 5', mRNA sequence
Length = 424
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 58 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 106
>gb|BE315863.2|BE315863 NF027C03LF1F1018 Developing leaf Medicago truncatula cDNA clone
NF027C03LF 5', mRNA sequence
Length = 271
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 46 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 94
>gb|BE317627.2|BE317627 NF054C12LF1F1086 Developing leaf Medicago truncatula cDNA clone
NF054C12LF 5', mRNA sequence
Length = 333
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 61 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 109
>gb|BE316289.2|BE316289 NF032C01LF1F1002 Developing leaf Medicago truncatula cDNA clone
NF032C01LF 5', mRNA sequence
Length = 353
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 46 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 94
>gb|BE318077.2|BE318077 NF062C09LF1F1066 Developing leaf Medicago truncatula cDNA clone
NF062C09LF 5', mRNA sequence
Length = 326
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 58 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 106
>gb|BE318120.2|BE318120 NF062G11LF1F1084 Developing leaf Medicago truncatula cDNA clone
NF062G11LF 5', mRNA sequence
Length = 321
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 46 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 94
>gb|BG448975.1|BG448975 NF003H12IN1F1104 Insect herbivory Medicago truncatula cDNA clone
NF003H12IN 5', mRNA sequence
Length = 393
Score = 50.1 bits (25), Expect = 3e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 132 gatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||| || ||||||||||||||||| || ||||| |||||||||
Sbjct: 35 gatgttgaataccgttgcttcgtcggaggtcttgcatgggccacc 79
>gb|BG581855.1|BG581855 EST483591 GVN Medicago truncatula cDNA clone pGVN-66E19 5' end,
mRNA sequence
Length = 529
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 53 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 101
>gb|BI263903.1|BI263903 NF092C05PL1F1038 Phosphate starved leaf Medicago truncatula cDNA
clone NF092C05PL 5', mRNA sequence
Length = 393
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 40 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 88
>gb|BI309824.1|BI309824 EST5311574 GESD Medicago truncatula cDNA clone pGESD4C2 5' end,
mRNA sequence
Length = 531
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 60 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 108
>gb|BQ139506.1|BQ139506 NF021A04PH1F1024 Phoma-infected Medicago truncatula cDNA clone
NF021A04PH 5', mRNA sequence
Length = 365
Score = 50.1 bits (25), Expect = 3e-004
Identities = 88/109 (80%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccaccagcaacgagtc 187
||||||||| || ||||| ||||||||||| || ||||| ||||||||| |||||| |
Sbjct: 53 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccaccgacaacgaagc 112
Query: 188 gctggagaatgccttcgcctcctacggcgagatcctcgactccaaggtc 236
|| ||||| |||||| | |||||||||||| | || |||||||||
Sbjct: 113 tctcgagaaagccttctctcaatacggcgagatcgttgattccaaggtc 161
>gb|AJ502053.1|AJ502053 AJ502053 MTAMP Medicago truncatula cDNA clone mtgmadc120015b07,
mRNA sequence
Length = 472
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 88 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 136
>gb|CA919363.1|CA919363 EST637081 MTUS Medicago truncatula cDNA clone MTUS-12F5, mRNA
sequence
Length = 667
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Minus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 606 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 558
>gb|CA921752.1|CA921752 EST639470 MTUS Medicago truncatula cDNA clone MTUS-44A5, mRNA
sequence
Length = 594
Score = 50.1 bits (25), Expect = 3e-004
Identities = 88/109 (80%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccaccagcaacgagtc 187
||||||||| || ||||| ||||||||||| || ||||| ||||||||| |||||| |
Sbjct: 15 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccaccgacaacgaagc 74
Query: 188 gctggagaatgccttcgcctcctacggcgagatcctcgactccaaggtc 236
|| ||||| |||||| | |||||||||||| | || |||||||||
Sbjct: 75 tctcgagaaagccttctctcaatacggcgagatcgttgattccaaggtc 123
>gb|CF068801.1|CF068801 EST669522 MTUS Medicago truncatula cDNA clone MTUS-12F5, mRNA
sequence
Length = 588
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 45 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 93
>gb|AJ846513.1|AJ846513 AJ846513 MtSCF Medicago truncatula cDNA clone MtCF05K21S6, mRNA
sequence
Length = 418
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 82 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 130
>gb|AJ847287.1|AJ847287 AJ847287 MtSTW Medicago truncatula cDNA clone MtTW07M24N2, mRNA
sequence
Length = 437
Score = 50.1 bits (25), Expect = 3e-004
Identities = 40/45 (88%)
Strand = Plus / Plus
Query: 132 gatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||| || ||||||||||||||||| || ||||| |||||||||
Sbjct: 40 gatgttgaataccgttgcttcgtcggaggtcttgcatgggccacc 84
>gb|CX524027.1|CX524027 s13dNF12G08AT056_447398 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 490
Score = 50.1 bits (25), Expect = 3e-004
Identities = 88/109 (80%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccaccagcaacgagtc 187
||||||||| || ||||| ||||||||||| || ||||| ||||||||| |||||| |
Sbjct: 70 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccaccgacaacgaagc 129
Query: 188 gctggagaatgccttcgcctcctacggcgagatcctcgactccaaggtc 236
|| ||||| |||||| | |||||||||||| | || |||||||||
Sbjct: 130 tctcgagaaagccttctctcaatacggcgagatcgttgattccaaggtc 178
>gb|CX525585.1|CX525585 s13dNF24G05AT040_479804 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 522
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 70 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 118
>gb|CX525951.1|CX525951 s13dNF32F09AT079_509646 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 627
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 49 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 97
>gb|CX526843.1|CX526843 s13dNF27C03AT022_514198 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 620
Score = 50.1 bits (25), Expect = 3e-004
Identities = 88/109 (80%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccaccagcaacgagtc 187
||||||||| || ||||| ||||||||||| || ||||| ||||||||| |||||| |
Sbjct: 60 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccaccgacaacgaagc 119
Query: 188 gctggagaatgccttcgcctcctacggcgagatcctcgactccaaggtc 236
|| ||||| |||||| | |||||||||||| | || |||||||||
Sbjct: 120 tctcgagaaagccttctctcaatacggcgagatcgttgattccaaggtc 168
>gb|CX528345.1|CX528345 s13dNF54D07AT062_517202 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 608
Score = 50.1 bits (25), Expect = 3e-004
Identities = 88/109 (80%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccaccagcaacgagtc 187
||||||||| || ||||| ||||||||||| || ||||| ||||||||| |||||| |
Sbjct: 49 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccaccgacaacgaagc 108
Query: 188 gctggagaatgccttcgcctcctacggcgagatcctcgactccaaggtc 236
|| ||||| |||||| | |||||||||||| | || |||||||||
Sbjct: 109 tctcgagaaagccttctctcaatacggcgagatcgttgattccaaggtc 157
>gb|CX532721.1|CX532721 s13dNF48A10MJ069_271725 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 334
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 61 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 109
>gb|CX534484.1|CX534484 s13dNF76F08MJ063_328564 Methyl Jasmonate-Elicited Root Cell
Suspension Culture Medicago truncatula cDNA, mRNA
sequence
Length = 415
Score = 50.1 bits (25), Expect = 3e-004
Identities = 43/49 (87%)
Strand = Plus / Plus
Query: 128 ggctgatgtggagtaccgttgcttcgtcggcgggcttgcctgggccacc 176
||||||||| || ||||| ||||||||||| || ||||| |||||||||
Sbjct: 56 ggctgatgttgaataccggtgcttcgtcggaggtcttgcatgggccacc 104
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 102,351
Number of Sequences: 392609
Number of extensions: 102351
Number of successful extensions: 6802
Number of sequences better than 0.5: 58
Number of HSP's better than 0.5 without gapping: 58
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 6651
Number of HSP's gapped (non-prelim): 151
length of query: 851
length of database: 441,732,993
effective HSP length: 20
effective length of query: 831
effective length of database: 433,880,813
effective search space: 360554955603
effective search space used: 360554955603
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)