BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131554.2.6
(761 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|CR325369.1| mte1-52L2FM1 BAC end, cultivar Jemalong A17... 70 3e-010
gb|AA660565.1|AA660565 00451 MtRHE Medicago truncatula cDNA... 70 3e-010
gb|AL376757.1|AL376757 MtBB25H10F1 MtBB Medicago truncatula... 70 3e-010
gb|AL376759.1|AL376759 MtBB26A01F1 MtBB Medicago truncatula... 70 3e-010
gb|AL376935.1|AL376935 MtBB27D06F1 MtBB Medicago truncatula... 70 3e-010
gb|BG453533.1|BG453533 NF092H12LF1F1101 Developing leaf Med... 70 3e-010
gb|AJ503553.1|AJ503553 AJ503553 MTAMP Medicago truncatula c... 70 3e-010
gb|AJ499142.1|AJ499142 AJ499142 MTPOSE Medicago truncatula ... 70 3e-010
gb|CX542343.1|CX542343 s13dNF82G09GS070_468002 Germinating ... 70 3e-010
gb|DW019200.1|DW019200 EST1228161 MTY Medicago truncatula c... 70 3e-010
gb|AC161749.3| Medicago truncatula chromosome 7 BAC clone m... 70 3e-010
gb|AL376936.1|AL376936 MtBB27D06R1 MtBB Medicago truncatula... 64 2e-008
gb|BI270932.1|BI270932 NF007C07FL1F1054 Developing flower M... 62 7e-008
gb|AL385795.1|AL385795 MtBC30F10R1 MtBC Medicago truncatula... 60 3e-007
gb|BE997504.1|BE997504 EST429227 GVSN Medicago truncatula c... 60 3e-007
gb|BQ150492.1|BQ150492 NF029G09LF1F1068 Developing leaf Med... 60 3e-007
gb|CF069854.1|CF069854 EST670575 MTUS Medicago truncatula c... 60 3e-007
gb|AC135801.24| Medicago truncatula clone mth2-23o16, compl... 60 3e-007
gb|AC142506.32| Medicago truncatula clone mth2-25k8, WORKIN... 60 3e-007
gb|AJ496937.1|AJ496937 AJ496937 MTFLOW Medicago truncatula ... 52 7e-005
gb|AJ497201.1|AJ497201 AJ497201 MTFLOW Medicago truncatula ... 52 7e-005
gb|AW560920.1|AW560920 EST315968 DSIR Medicago truncatula c... 50 3e-004
gb|AL375561.1|AL375561 MtBB15E04F1 MtBB Medicago truncatula... 50 3e-004
gb|AL375562.1|AL375562 MtBB15E04R1 MtBB Medicago truncatula... 50 3e-004
gb|AL376208.1|AL376208 MtBB22A10F1 MtBB Medicago truncatula... 50 3e-004
gb|AL376880.1|AL376880 MtBB27A09F1 MtBB Medicago truncatula... 50 3e-004
gb|AL376881.1|AL376881 MtBB27A09R1 MtBB Medicago truncatula... 50 3e-004
gb|AL380016.1|AL380016 MtBB48G10F1 MtBB Medicago truncatula... 50 3e-004
gb|AL380017.1|AL380017 MtBB48G10R1 MtBB Medicago truncatula... 50 3e-004
gb|BG581231.1|BG581231 EST482964 GVN Medicago truncatula cD... 50 3e-004
gb|BQ146587.1|BQ146587 NF014B10FL1F1080 Developing flower M... 50 3e-004
gb|AJ498814.1|AJ498814 AJ498814 MTPOSE Medicago truncatula ... 50 3e-004
gb|CA919937.1|CA919937 EST637655 MTUS Medicago truncatula c... 50 3e-004
gb|CF069447.1|CF069447 EST670168 MTUS Medicago truncatula c... 50 3e-004
gb|CX541861.1|CX541861 s13dNF71F10GS091_467030 Germinating ... 50 3e-004
gb|CX542226.1|CX542226 s13dNF86H02GS016_467760 Germinating ... 50 3e-004
gb|AC142498.21| Medicago truncatula clone mth2-24a18, compl... 50 3e-004
emb|CT573029.4| Medicago truncatula chromosome 3 clone MTH2... 50 3e-004
gb|BE239642.1|BE239642 EST403691 MHRP- Medicago truncatula ... 46 0.004
gb|AJ389014.1|AJ389014 AJ389014 Medicago truncatula R108 Me... 44 0.017
gb|AL380165.1|AL380165 MtBB50G12F1 MtBB Medicago truncatula... 44 0.017
gb|AL380166.1|AL380166 MtBB50G12R1 MtBB Medicago truncatula... 44 0.017
gb|AJ500970.1|AJ500970 AJ500970 MTAMP Medicago truncatula c... 44 0.017
gb|AJ498812.1|AJ498812 AJ498812 MTPOSE Medicago truncatula ... 44 0.017
gb|AJ498978.1|AJ498978 AJ498978 MTPOSE Medicago truncatula ... 44 0.017
gb|AL366317.1|AL366317 MtBA06H01F1 MtBA Medicago truncatula... 42 0.067
gb|AC146561.22| Medicago truncatula clone mth2-12j18, compl... 42 0.067
emb|CT573053.1| Medicago truncatula chromosome 5 clone mte1... 42 0.067
gb|AL379622.1|AL379622 MtBB46D08F1 MtBB Medicago truncatula... 40 0.27
gb|AL379623.1|AL379623 MtBB46D08R1 MtBB Medicago truncatula... 40 0.27
gb|AJ497947.1|AJ497947 AJ497947 MTFLOW Medicago truncatula ... 40 0.27
gb|AJ846792.1|AJ846792 AJ846792 MtSN0 Medicago truncatula c... 40 0.27
gb|AC148344.22| Medicago truncatula clone mth2-21b15, WORKI... 40 0.27
>emb|CR325369.1| mte1-52L2FM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 730
Score = 69.9 bits (35), Expect = 3e-010
Identities = 134/167 (80%)
Strand = Plus / Plus
Query: 457 tgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatcttgagcacaccg 516
||||| ||||| || || || ||||| || || ||||| |||||||||||||| ||||||
Sbjct: 538 tgctcagtgtaagtaacagcatcacgaatcacattctcaagaaagatcttgagaacaccg 597
Query: 517 cgggtctcctcgtagatgagcccggagatgcgcttgacgccgcccctcctagccagcctc 576
|| ||||| ||||||||||| ||| ||| | ||| || || || | ||| || || |
Sbjct: 598 cgagtctcttcgtagatgagaccgctgattctcttcacaccaccacgccttgcaagacga 657
Query: 577 cggatcgccggcttggtgatgccctggatgttgtcgcgcaggacctt 623
|| ||||| |||||||| ||||| |||||||||||||| || |||||
Sbjct: 658 cgaatcgcaggcttggttatgccttggatgttgtcgcgaagaacctt 704
>gb|AA660565.1|AA660565 00451 MtRHE Medicago truncatula cDNA 5' similar to histone H4, mRNA
sequence
Length = 494
Score = 69.9 bits (35), Expect = 3e-010
Identities = 134/167 (80%)
Strand = Plus / Minus
Query: 457 tgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatcttgagcacaccg 516
||||| ||||| || || || ||||| || || ||||| |||||||||||||| ||||||
Sbjct: 267 tgctcagtgtaagtaacagcatcacgaatcacattctcaagaaagatcttgagaacaccg 208
Query: 517 cgggtctcctcgtagatgagcccggagatgcgcttgacgccgcccctcctagccagcctc 576
|| ||||| ||||||||||| ||| ||| | ||| || || || | ||| || || |
Sbjct: 207 cgagtctcttcgtagatgagaccgctgattctcttcacaccaccacgccttgcaagacga 148
Query: 577 cggatcgccggcttggtgatgccctggatgttgtcgcgcaggacctt 623
|| ||||| |||||||| ||||| |||||||||||||| || |||||
Sbjct: 147 cgaatcgcaggcttggttatgccttggatgttgtcgcgaagaacctt 101
>gb|AL376757.1|AL376757 MtBB25H10F1 MtBB Medicago truncatula cDNA clone MtBB25H10 T3, mRNA
sequence
Length = 298
Score = 69.9 bits (35), Expect = 3e-010
Identities = 134/167 (80%)
Strand = Plus / Minus
Query: 457 tgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatcttgagcacaccg 516
||||| ||||| || || || ||||| || || ||||| |||||||||||||| ||||||
Sbjct: 258 tgctcagtgtaagtaacagcatcacgaatcacattctcaagaaagatcttgagaacaccg 199
Query: 517 cgggtctcctcgtagatgagcccggagatgcgcttgacgccgcccctcctagccagcctc 576
|| ||||| ||||||||||| ||| ||| | ||| || || || | ||| || || |
Sbjct: 198 cgagtctcttcgtagatgagaccgctgattctcttcacaccaccacgccttgcaagacga 139
Query: 577 cggatcgccggcttggtgatgccctggatgttgtcgcgcaggacctt 623
|| ||||| |||||||| ||||| |||||||||||||| || |||||
Sbjct: 138 cgaatcgcaggcttggttatgccttggatgttgtcgcgaagaacctt 92
>gb|AL376759.1|AL376759 MtBB26A01F1 MtBB Medicago truncatula cDNA clone MtBB26A01 T3, mRNA
sequence
Length = 460
Score = 69.9 bits (35), Expect = 3e-010
Identities = 134/167 (80%)
Strand = Plus / Minus
Query: 457 tgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatcttgagcacaccg 516
||||| ||||| || || || ||||| || || ||||| |||||||||||||| ||||||
Sbjct: 259 tgctcagtgtaagtaacagcatcacgaatcacattctcaagaaagatcttgagaacaccg 200
Query: 517 cgggtctcctcgtagatgagcccggagatgcgcttgacgccgcccctcctagccagcctc 576
|| ||||| ||||||||||| ||| ||| | ||| || || || | ||| || || |
Sbjct: 199 cgagtctcttcgtagatgagaccgctgattctcttcacaccaccacgccttgcaagacga 140
Query: 577 cggatcgccggcttggtgatgccctggatgttgtcgcgcaggacctt 623
|| ||||| |||||||| ||||| |||||||||||||| || |||||
Sbjct: 139 cgaatcgcaggcttggttatgccttggatgttgtcgcgaagaacctt 93
>gb|AL376935.1|AL376935 MtBB27D06F1 MtBB Medicago truncatula cDNA clone MtBB27D06 T3, mRNA
sequence
Length = 469
Score = 69.9 bits (35), Expect = 3e-010
Identities = 134/167 (80%)
Strand = Plus / Minus
Query: 457 tgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatcttgagcacaccg 516
||||| ||||| || || || ||||| || || ||||| |||||||||||||| ||||||
Sbjct: 243 tgctcagtgtaagtaacagcatcacgaatcacattctcaagaaagatcttgagaacaccg 184
Query: 517 cgggtctcctcgtagatgagcccggagatgcgcttgacgccgcccctcctagccagcctc 576
|| ||||| ||||||||||| ||| ||| | ||| || || || | ||| || || |
Sbjct: 183 cgagtctcttcgtagatgagaccgctgattctcttcacaccaccacgccttgcaagacga 124
Query: 577 cggatcgccggcttggtgatgccctggatgttgtcgcgcaggacctt 623
|| ||||| |||||||| ||||| |||||||||||||| || |||||
Sbjct: 123 cgaatcgcaggcttggttatgccttggatgttgtcgcgaagaacctt 77
>gb|BG453533.1|BG453533 NF092H12LF1F1101 Developing leaf Medicago truncatula cDNA clone
NF092H12LF 5', mRNA sequence
Length = 445
Score = 69.9 bits (35), Expect = 3e-010
Identities = 134/167 (80%)
Strand = Plus / Minus
Query: 457 tgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatcttgagcacaccg 516
||||| ||||| || || || ||||| || || ||||| |||||||||||||| ||||||
Sbjct: 205 tgctcagtgtaagtaacagcatcacgaatcacattctcaagaaagatcttgagaacaccg 146
Query: 517 cgggtctcctcgtagatgagcccggagatgcgcttgacgccgcccctcctagccagcctc 576
|| ||||| ||||||||||| ||| ||| | ||| || || || | ||| || || |
Sbjct: 145 cgagtctcttcgtagatgagaccgctgattctcttcacaccaccacgccttgcaagacga 86
Query: 577 cggatcgccggcttggtgatgccctggatgttgtcgcgcaggacctt 623
|| ||||| |||||||| ||||| |||||||||||||| || |||||
Sbjct: 85 cgaatcgcaggcttggttatgccttggatgttgtcgcgaagaacctt 39
>gb|AJ503553.1|AJ503553 AJ503553 MTAMP Medicago truncatula cDNA clone mtgmadc120035d10,
mRNA sequence
Length = 390
Score = 69.9 bits (35), Expect = 3e-010
Identities = 134/167 (80%)
Strand = Plus / Minus
Query: 457 tgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatcttgagcacaccg 516
||||| ||||| || || || ||||| || || ||||| |||||||||||||| ||||||
Sbjct: 298 tgctcagtgtaagtaacagcatcacgaatcacattctcaagaaagatcttgagaacaccg 239
Query: 517 cgggtctcctcgtagatgagcccggagatgcgcttgacgccgcccctcctagccagcctc 576
|| ||||| ||||||||||| ||| ||| | ||| || || || | ||| || || |
Sbjct: 238 cgagtctcttcgtagatgagaccgctgattctcttcacaccaccacgccttgcaagacga 179
Query: 577 cggatcgccggcttggtgatgccctggatgttgtcgcgcaggacctt 623
|| ||||| |||||||| ||||| |||||||||||||| || |||||
Sbjct: 178 cgaatcgcaggcttggttatgccttggatgttgtcgcgaagaacctt 132
>gb|AJ499142.1|AJ499142 AJ499142 MTPOSE Medicago truncatula cDNA clone mt--acc955212f10,
mRNA sequence
Length = 542
Score = 69.9 bits (35), Expect = 3e-010
Identities = 134/167 (80%)
Strand = Plus / Minus
Query: 457 tgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatcttgagcacaccg 516
||||| ||||| || || || ||||| || || ||||| |||||||||||||| ||||||
Sbjct: 302 tgctcagtgtaagtaacagcatcacgaatcacattctcaagaaagatcttgagaacaccg 243
Query: 517 cgggtctcctcgtagatgagcccggagatgcgcttgacgccgcccctcctagccagcctc 576
|| ||||| ||||||||||| ||| ||| | ||| || || || | ||| || || |
Sbjct: 242 cgagtctcttcgtagatgagaccgctgattctcttcacaccaccacgccttgcaagacga 183
Query: 577 cggatcgccggcttggtgatgccctggatgttgtcgcgcaggacctt 623
|| ||||| |||||||| ||||| |||||||||||||| || |||||
Sbjct: 182 cgaatcgcaggcttggttatgccttggatgttgtcgcgaagaacctt 136
>gb|CX542343.1|CX542343 s13dNF82G09GS070_468002 Germinating Seed Medicago truncatula cDNA,
mRNA sequence
Length = 520
Score = 69.9 bits (35), Expect = 3e-010
Identities = 134/167 (80%)
Strand = Plus / Minus
Query: 457 tgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatcttgagcacaccg 516
||||| ||||| || || || ||||| || || ||||| |||||||||||||| ||||||
Sbjct: 278 tgctcagtgtaagtaacagcatcacgaatcacattctcaagaaagatcttgagaacaccg 219
Query: 517 cgggtctcctcgtagatgagcccggagatgcgcttgacgccgcccctcctagccagcctc 576
|| ||||| ||||||||||| ||| ||| | ||| || || || | ||| || || |
Sbjct: 218 cgagtctcttcgtagatgagaccgctgattctcttcacaccaccacgccttgcaagacga 159
Query: 577 cggatcgccggcttggtgatgccctggatgttgtcgcgcaggacctt 623
|| ||||| |||||||| ||||| |||||||||||||| || |||||
Sbjct: 158 cgaatcgcaggcttggttatgccttggatgttgtcgcgaagaacctt 112
>gb|DW019200.1|DW019200 EST1228161 MTY Medicago truncatula cDNA clone MTYBG13, mRNA
sequence
Length = 546
Score = 69.9 bits (35), Expect = 3e-010
Identities = 134/167 (80%)
Strand = Plus / Minus
Query: 457 tgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatcttgagcacaccg 516
||||| ||||| || || || ||||| || || ||||| |||||||||||||| ||||||
Sbjct: 307 tgctcagtgtaagtaacagcatcacgaatcacattctcaagaaagatcttgagaacaccg 248
Query: 517 cgggtctcctcgtagatgagcccggagatgcgcttgacgccgcccctcctagccagcctc 576
|| ||||| ||||||||||| ||| ||| | ||| || || || | ||| || || |
Sbjct: 247 cgagtctcttcgtagatgagaccgctgattctcttcacaccaccacgccttgcaagacga 188
Query: 577 cggatcgccggcttggtgatgccctggatgttgtcgcgcaggacctt 623
|| ||||| |||||||| ||||| |||||||||||||| || |||||
Sbjct: 187 cgaatcgcaggcttggttatgccttggatgttgtcgcgaagaacctt 141
>gb|AC161749.3| Medicago truncatula chromosome 7 BAC clone mth2-182g1, complete
sequence
Length = 47909
Score = 69.9 bits (35), Expect = 3e-010
Identities = 134/167 (80%)
Strand = Plus / Plus
Query: 457 tgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatcttgagcacaccg 516
||||| ||||| || || || ||||| || || ||||| |||||||||||||| ||||||
Sbjct: 26492 tgctcagtgtaagtaacagcatcacgaatcacattctcaagaaagatcttgagaacaccg 26551
Query: 517 cgggtctcctcgtagatgagcccggagatgcgcttgacgccgcccctcctagccagcctc 576
|| ||||| ||||||||||| ||| ||| | ||| || || || | ||| || || |
Sbjct: 26552 cgagtctcttcgtagatgagaccgctgattctcttcacaccaccacgccttgcaagacga 26611
Query: 577 cggatcgccggcttggtgatgccctggatgttgtcgcgcaggacctt 623
|| ||||| |||||||| ||||| |||||||||||||| || |||||
Sbjct: 26612 cgaatcgcaggcttggttatgccttggatgttgtcgcgaagaacctt 26658
>gb|AL376936.1|AL376936 MtBB27D06R1 MtBB Medicago truncatula cDNA clone MtBB27D06 T7, mRNA
sequence
Length = 465
Score = 63.9 bits (32), Expect = 2e-008
Identities = 68/80 (85%)
Strand = Plus / Minus
Query: 457 tgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatcttgagcacaccg 516
||||| ||||| || || || ||||| || || ||||| |||||||||||||| ||||||
Sbjct: 204 tgctcagtgtaagtaacagcatcacgaatcacattctcaagaaagatcttgagaacaccg 145
Query: 517 cgggtctcctcgtagatgag 536
|| ||||| |||||||||||
Sbjct: 144 cgagtctcttcgtagatgag 125
>gb|BI270932.1|BI270932 NF007C07FL1F1054 Developing flower Medicago truncatula cDNA clone
NF007C07FL 5', mRNA sequence
Length = 354
Score = 61.9 bits (31), Expect = 7e-008
Identities = 133/167 (79%)
Strand = Plus / Minus
Query: 457 tgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatcttgagcacaccg 516
||||| ||||| || || || ||||| || || ||||| |||||||||||||| ||||||
Sbjct: 284 tgctcagtgtaagtaacagcatcacgaatcacattctcaagaaagatcttgagaacaccg 225
Query: 517 cgggtctcctcgtagatgagcccggagatgcgcttgacgccgcccctcctagccagcctc 576
|| |||| ||||||||||| ||| ||| | ||| || || || | ||| || || |
Sbjct: 224 cgagtctgttcgtagatgagaccgctgattctcttcacaccaccacgccttgcaagacga 165
Query: 577 cggatcgccggcttggtgatgccctggatgttgtcgcgcaggacctt 623
|| ||||| |||||||| ||||| |||||||||||||| || |||||
Sbjct: 164 cgaatcgcaggcttggttatgccttggatgttgtcgcgaagaacctt 118
>gb|AL385795.1|AL385795 MtBC30F10R1 MtBC Medicago truncatula cDNA clone MtBC30F10 T7, mRNA
sequence
Length = 526
Score = 60.0 bits (30), Expect = 3e-007
Identities = 84/102 (82%)
Strand = Plus / Minus
Query: 408 cttgagcgcgtagacgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgta 467
|||||| ||||| || |||||||| || || || ||||| ||||| || ||||| |||||
Sbjct: 313 cttgagagcgtaaacaacatccattgcagtaacagtcttacggcgagcatgctctgtgta 254
Query: 468 ggtgacggcgtcacggatgacgttctccagaaagatcttgag 509
||||| || ||||| || || ||||| ||||||||||||||
Sbjct: 253 tgtgacagcatcacgaatcacattctcaagaaagatcttgag 212
Score = 52.0 bits (26), Expect = 7e-005
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 580 atcgccggcttggtgatgccctggatgttgtcgcgcaggaccttgcggtg 629
||||| ||||| ||||| ||||||||||| |||||||| ||||| |||||
Sbjct: 141 atcgcaggctttgtgattccctggatgttatcgcgcagaaccttacggtg 92
>gb|BE997504.1|BE997504 EST429227 GVSN Medicago truncatula cDNA clone pGVSN-1E24, mRNA
sequence
Length = 391
Score = 60.0 bits (30), Expect = 3e-007
Identities = 84/102 (82%)
Strand = Plus / Minus
Query: 408 cttgagcgcgtagacgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgta 467
|||||| ||||| || |||||||| || || || ||||| ||||| || ||||| |||||
Sbjct: 266 cttgagagcgtaaacaacatccattgcagtaacagtcttacggcgagcatgctctgtgta 207
Query: 468 ggtgacggcgtcacggatgacgttctccagaaagatcttgag 509
||||| || ||||| || || ||||| ||||||||||||||
Sbjct: 206 tgtgacagcatcacgaatcacattctcaagaaagatcttgag 165
Score = 52.0 bits (26), Expect = 7e-005
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 580 atcgccggcttggtgatgccctggatgttgtcgcgcaggaccttgcggtg 629
||||| ||||| ||||| ||||||||||| |||||||| ||||| |||||
Sbjct: 94 atcgcaggctttgtgattccctggatgttatcgcgcagaaccttacggtg 45
>gb|BQ150492.1|BQ150492 NF029G09LF1F1068 Developing leaf Medicago truncatula cDNA clone
NF029G09LF 5', mRNA sequence
Length = 821
Score = 60.0 bits (30), Expect = 3e-007
Identities = 84/102 (82%)
Strand = Plus / Minus
Query: 408 cttgagcgcgtagacgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgta 467
|||||| ||||| || |||||||| || || || ||||| ||||| || ||||| |||||
Sbjct: 405 cttgagagcgtaaacaacatccattgcagtaacagtcttacggcgagcatgctctgtgta 346
Query: 468 ggtgacggcgtcacggatgacgttctccagaaagatcttgag 509
||||| || ||||| || || ||||| ||||||||||||||
Sbjct: 345 tgtgacagcatcacgaatcacattctcaagaaagatcttgag 304
Score = 52.0 bits (26), Expect = 7e-005
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 580 atcgccggcttggtgatgccctggatgttgtcgcgcaggaccttgcggtg 629
||||| ||||| ||||| ||||||||||| |||||||| ||||| |||||
Sbjct: 233 atcgcaggctttgtgattccctggatgttatcgcgcagaaccttacggtg 184
>gb|CF069854.1|CF069854 EST670575 MTUS Medicago truncatula cDNA clone MTUS-25A9, mRNA
sequence
Length = 349
Score = 60.0 bits (30), Expect = 3e-007
Identities = 84/102 (82%)
Strand = Plus / Minus
Query: 408 cttgagcgcgtagacgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgta 467
|||||| ||||| || |||||||| || || || ||||| ||||| || ||||| |||||
Sbjct: 224 cttgagagcgtaaacaacatccattgcagtaacagtcttacggcgagcatgctctgtgta 165
Query: 468 ggtgacggcgtcacggatgacgttctccagaaagatcttgag 509
||||| || ||||| || || ||||| ||||||||||||||
Sbjct: 164 tgtgacagcatcacgaatcacattctcaagaaagatcttgag 123
Score = 52.0 bits (26), Expect = 7e-005
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 580 atcgccggcttggtgatgccctggatgttgtcgcgcaggaccttgcggtg 629
||||| ||||| ||||| ||||||||||| |||||||| ||||| |||||
Sbjct: 52 atcgcaggctttgtgattccctggatgttatcgcgcagaaccttacggtg 3
>gb|AC135801.24| Medicago truncatula clone mth2-23o16, complete sequence
Length = 115452
Score = 60.0 bits (30), Expect = 3e-007
Identities = 84/102 (82%)
Strand = Plus / Plus
Query: 408 cttgagcgcgtagacgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgta 467
|||||| ||||| || |||||||| || || || ||||| ||||| || ||||| |||||
Sbjct: 7137 cttgagagcgtaaacaacatccattgcagtaacagtcttacggcgagcatgctctgtgta 7196
Query: 468 ggtgacggcgtcacggatgacgttctccagaaagatcttgag 509
||||| || ||||| || || ||||| ||||||||||||||
Sbjct: 7197 tgtgacagcatcacgaatcacattctcaagaaagatcttgag 7238
Score = 52.0 bits (26), Expect = 7e-005
Identities = 44/50 (88%)
Strand = Plus / Plus
Query: 580 atcgccggcttggtgatgccctggatgttgtcgcgcaggaccttgcggtg 629
||||| ||||| ||||| ||||||||||| |||||||| ||||| |||||
Sbjct: 7309 atcgcaggctttgtgattccctggatgttatcgcgcagaaccttacggtg 7358
>gb|AC142506.32| Medicago truncatula clone mth2-25k8, WORKING DRAFT SEQUENCE, 2 ordered
pieces
Length = 126872
Score = 60.0 bits (30), Expect = 3e-007
Identities = 84/102 (82%)
Strand = Plus / Plus
Query: 408 cttgagcgcgtagacgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgta 467
|||||| ||||| || |||||||| || || || ||||| ||||| || ||||| |||||
Sbjct: 99942 cttgagagcgtaaacaacatccattgcagtaacagtcttacggcgagcatgctctgtgta 100001
Query: 468 ggtgacggcgtcacggatgacgttctccagaaagatcttgag 509
||||| || ||||| || || ||||| ||||||||||||||
Sbjct: 100002 tgtgacagcatcacgaatcacattctcaagaaagatcttgag 100043
Score = 52.0 bits (26), Expect = 7e-005
Identities = 44/50 (88%)
Strand = Plus / Plus
Query: 580 atcgccggcttggtgatgccctggatgttgtcgcgcaggaccttgcggtg 629
||||| ||||| ||||| ||||||||||| |||||||| ||||| |||||
Sbjct: 100114 atcgcaggctttgtgattccctggatgttatcgcgcagaaccttacggtg 100163
>gb|AJ496937.1|AJ496937 AJ496937 MTFLOW Medicago truncatula cDNA clone mt--abc955101h12,
mRNA sequence
Length = 312
Score = 52.0 bits (26), Expect = 7e-005
Identities = 41/46 (89%)
Strand = Plus / Minus
Query: 454 gcgtgctcggtgtaggtgacggcgtcacggatgacgttctccagaa 499
|||||||| ||||| ||||| || ||||||||||| ||||||||||
Sbjct: 47 gcgtgctcagtgtatgtgaccgcatcacggatgacattctccagaa 2
>gb|AJ497201.1|AJ497201 AJ497201 MTFLOW Medicago truncatula cDNA clone mt--abc955106b03,
mRNA sequence
Length = 251
Score = 52.0 bits (26), Expect = 7e-005
Identities = 44/50 (88%)
Strand = Plus / Minus
Query: 580 atcgccggcttggtgatgccctggatgttgtcgcgcaggaccttgcggtg 629
||||| ||||| ||||| ||||||||||| |||||||| ||||| |||||
Sbjct: 143 atcgcaggctttgtgattccctggatgttatcgcgcagaaccttacggtg 94
>gb|AW560920.1|AW560920 EST315968 DSIR Medicago truncatula cDNA clone pDSIR-30D19, mRNA
sequence
Length = 557
Score = 50.1 bits (25), Expect = 3e-004
Identities = 46/53 (86%)
Strand = Plus / Minus
Query: 454 gcgtgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatctt 506
|||||||| ||||| ||||| || ||||||||||| ||||||| ||||||||
Sbjct: 287 gcgtgctcagtgtatgtgaccgcatcacggatgacattctccaagaagatctt 235
Score = 42.1 bits (21), Expect = 0.067
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 586 ggcttggtgatgccctggatgttgtcgcg 614
||||| ||||| |||||||||||||||||
Sbjct: 155 ggcttagtgataccctggatgttgtcgcg 127
>gb|AL375561.1|AL375561 MtBB15E04F1 MtBB Medicago truncatula cDNA clone MtBB15E04 T3, mRNA
sequence
Length = 481
Score = 50.1 bits (25), Expect = 3e-004
Identities = 46/53 (86%)
Strand = Plus / Minus
Query: 454 gcgtgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatctt 506
|||||||| ||||| ||||| || ||||||||||| ||||||| ||||||||
Sbjct: 298 gcgtgctcagtgtatgtgaccgcatcacggatgacattctccaagaagatctt 246
Score = 42.1 bits (21), Expect = 0.067
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 586 ggcttggtgatgccctggatgttgtcgcg 614
||||| ||||| |||||||||||||||||
Sbjct: 166 ggcttagtgataccctggatgttgtcgcg 138
>gb|AL375562.1|AL375562 MtBB15E04R1 MtBB Medicago truncatula cDNA clone MtBB15E04 T7, mRNA
sequence
Length = 550
Score = 50.1 bits (25), Expect = 3e-004
Identities = 46/53 (86%)
Strand = Plus / Minus
Query: 454 gcgtgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatctt 506
|||||||| ||||| ||||| || ||||||||||| ||||||| ||||||||
Sbjct: 241 gcgtgctcagtgtatgtgaccgcatcacggatgacattctccaagaagatctt 189
Score = 42.1 bits (21), Expect = 0.067
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 586 ggcttggtgatgccctggatgttgtcgcg 614
||||| ||||| |||||||||||||||||
Sbjct: 109 ggcttagtgataccctggatgttgtcgcg 81
>gb|AL376208.1|AL376208 MtBB22A10F1 MtBB Medicago truncatula cDNA clone MtBB22A10 T3, mRNA
sequence
Length = 446
Score = 50.1 bits (25), Expect = 3e-004
Identities = 46/53 (86%)
Strand = Plus / Minus
Query: 454 gcgtgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatctt 506
|||||||| ||||| ||||| || ||||||||||| ||||||| ||||||||
Sbjct: 122 gcgtgctcagtgtatgtgaccgcatcacggatgacattctccaagaagatctt 70
>gb|AL376880.1|AL376880 MtBB27A09F1 MtBB Medicago truncatula cDNA clone MtBB27A09 T3, mRNA
sequence
Length = 479
Score = 50.1 bits (25), Expect = 3e-004
Identities = 46/53 (86%)
Strand = Plus / Minus
Query: 454 gcgtgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatctt 506
|||||||| ||||| ||||| || ||||||||||| ||||||| ||||||||
Sbjct: 292 gcgtgctcagtgtatgtgaccgcatcacggatgacattctccaagaagatctt 240
Score = 42.1 bits (21), Expect = 0.067
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 586 ggcttggtgatgccctggatgttgtcgcg 614
||||| ||||| |||||||||||||||||
Sbjct: 160 ggcttagtgataccctggatgttgtcgcg 132
>gb|AL376881.1|AL376881 MtBB27A09R1 MtBB Medicago truncatula cDNA clone MtBB27A09 T7, mRNA
sequence
Length = 497
Score = 50.1 bits (25), Expect = 3e-004
Identities = 46/53 (86%)
Strand = Plus / Minus
Query: 454 gcgtgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatctt 506
|||||||| ||||| ||||| || ||||||||||| ||||||| ||||||||
Sbjct: 195 gcgtgctcagtgtatgtgaccgcatcacggatgacattctccaagaagatctt 143
Score = 42.1 bits (21), Expect = 0.067
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 586 ggcttggtgatgccctggatgttgtcgcg 614
||||| ||||| |||||||||||||||||
Sbjct: 63 ggcttagtgataccctggatgttgtcgcg 35
>gb|AL380016.1|AL380016 MtBB48G10F1 MtBB Medicago truncatula cDNA clone MtBB48G10 T3, mRNA
sequence
Length = 492
Score = 50.1 bits (25), Expect = 3e-004
Identities = 73/89 (82%)
Strand = Plus / Minus
Query: 418 tagacgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcg 477
||||| |||||||||||||| || ||||| | | |||||||| ||||| || || ||
Sbjct: 285 tagacaacatccatggcggtaacagtcttcctcctagcgtgctcagtgtatgtaactgca 226
Query: 478 tcacggatgacgttctccagaaagatctt 506
||||||||||| ||||||| ||||||||
Sbjct: 225 tcacggatgacattctccaagaagatctt 197
>gb|AL380017.1|AL380017 MtBB48G10R1 MtBB Medicago truncatula cDNA clone MtBB48G10 T7, mRNA
sequence
Length = 521
Score = 50.1 bits (25), Expect = 3e-004
Identities = 73/89 (82%)
Strand = Plus / Minus
Query: 418 tagacgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcg 477
||||| |||||||||||||| || ||||| | | |||||||| ||||| || || ||
Sbjct: 285 tagacaacatccatggcggtaacagtcttcctcctagcgtgctcagtgtatgtaactgca 226
Query: 478 tcacggatgacgttctccagaaagatctt 506
||||||||||| ||||||| ||||||||
Sbjct: 225 tcacggatgacattctccaagaagatctt 197
>gb|BG581231.1|BG581231 EST482964 GVN Medicago truncatula cDNA clone pGVN-64M5 5' end, mRNA
sequence
Length = 440
Score = 50.1 bits (25), Expect = 3e-004
Identities = 73/89 (82%)
Strand = Plus / Minus
Query: 418 tagacgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcg 477
||||| |||||||||||||| || ||||| | | |||||||| ||||| || || ||
Sbjct: 257 tagacaacatccatggcggtaacagtcttcctcctagcgtgctcagtgtatgtaactgca 198
Query: 478 tcacggatgacgttctccagaaagatctt 506
||||||||||| ||||||| ||||||||
Sbjct: 197 tcacggatgacattctccaagaagatctt 169
>gb|BQ146587.1|BQ146587 NF014B10FL1F1080 Developing flower Medicago truncatula cDNA clone
NF014B10FL 5', mRNA sequence
Length = 815
Score = 50.1 bits (25), Expect = 3e-004
Identities = 73/89 (82%)
Strand = Plus / Minus
Query: 418 tagacgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcg 477
||||| |||||||||||||| || ||||| | | |||||||| ||||| || || ||
Sbjct: 436 tagacaacatccatggcggtaacagtcttcctcctagcgtgctcagtgtatgtaactgca 377
Query: 478 tcacggatgacgttctccagaaagatctt 506
||||||||||| ||||||| ||||||||
Sbjct: 376 tcacggatgacattctccaagaagatctt 348
>gb|AJ498814.1|AJ498814 AJ498814 MTPOSE Medicago truncatula cDNA clone mt--acc955209a02,
mRNA sequence
Length = 572
Score = 50.1 bits (25), Expect = 3e-004
Identities = 46/53 (86%)
Strand = Plus / Minus
Query: 454 gcgtgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatctt 506
|||||||| ||||| ||||| || ||||||||||| ||||||| ||||||||
Sbjct: 309 gcgtgctcagtgtatgtgaccgcatcacggatgacattctccaagaagatctt 257
Score = 42.1 bits (21), Expect = 0.067
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 586 ggcttggtgatgccctggatgttgtcgcg 614
||||| ||||| |||||||||||||||||
Sbjct: 177 ggcttagtgataccctggatgttgtcgcg 149
>gb|CA919937.1|CA919937 EST637655 MTUS Medicago truncatula cDNA clone MTUS-20D9, mRNA
sequence
Length = 457
Score = 50.1 bits (25), Expect = 3e-004
Identities = 73/89 (82%)
Strand = Plus / Plus
Query: 418 tagacgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcg 477
||||| |||||||||||||| || ||||| | | |||||||| ||||| || || ||
Sbjct: 163 tagacaacatccatggcggtaacagtcttcctcctagcgtgctcagtgtatgtaactgca 222
Query: 478 tcacggatgacgttctccagaaagatctt 506
||||||||||| ||||||| ||||||||
Sbjct: 223 tcacggatgacattctccaagaagatctt 251
>gb|CF069447.1|CF069447 EST670168 MTUS Medicago truncatula cDNA clone MTUS-20D9, mRNA
sequence
Length = 441
Score = 50.1 bits (25), Expect = 3e-004
Identities = 73/89 (82%)
Strand = Plus / Minus
Query: 418 tagacgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcg 477
||||| |||||||||||||| || ||||| | | |||||||| ||||| || || ||
Sbjct: 258 tagacaacatccatggcggtaacagtcttcctcctagcgtgctcagtgtatgtaactgca 199
Query: 478 tcacggatgacgttctccagaaagatctt 506
||||||||||| ||||||| ||||||||
Sbjct: 198 tcacggatgacattctccaagaagatctt 170
>gb|CX541861.1|CX541861 s13dNF71F10GS091_467030 Germinating Seed Medicago truncatula cDNA,
mRNA sequence
Length = 467
Score = 50.1 bits (25), Expect = 3e-004
Identities = 73/89 (82%)
Strand = Plus / Plus
Query: 418 tagacgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcg 477
||||| |||||||||||||| || ||||| | | |||||||| ||||| || || ||
Sbjct: 180 tagacaacatccatggcggtaacagtcttcctcctagcgtgctcagtgtatgtaactgca 239
Query: 478 tcacggatgacgttctccagaaagatctt 506
||||||||||| ||||||| ||||||||
Sbjct: 240 tcacggatgacattctccaagaagatctt 268
>gb|CX542226.1|CX542226 s13dNF86H02GS016_467760 Germinating Seed Medicago truncatula cDNA,
mRNA sequence
Length = 507
Score = 50.1 bits (25), Expect = 3e-004
Identities = 73/89 (82%)
Strand = Plus / Minus
Query: 418 tagacgacatccatggcggtgacggtcttgcggcgggcgtgctcggtgtaggtgacggcg 477
||||| |||||||||||||| || ||||| | | |||||||| ||||| || || ||
Sbjct: 324 tagacaacatccatggcggtaacagtcttcctcctagcgtgctcagtgtatgtaactgca 265
Query: 478 tcacggatgacgttctccagaaagatctt 506
||||||||||| ||||||| ||||||||
Sbjct: 264 tcacggatgacattctccaagaagatctt 236
>gb|AC142498.21| Medicago truncatula clone mth2-24a18, complete sequence
Length = 114956
Score = 50.1 bits (25), Expect = 3e-004
Identities = 46/53 (86%)
Strand = Plus / Plus
Query: 454 gcgtgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatctt 506
|||||||| ||||| ||||| || ||||||||||| ||||||| ||||||||
Sbjct: 40423 gcgtgctcagtgtatgtgaccgcatcacggatgacattctccaagaagatctt 40475
Score = 42.1 bits (21), Expect = 0.067
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 586 ggcttggtgatgccctggatgttgtcgcg 614
||||| ||||| |||||||||||||||||
Sbjct: 40555 ggcttagtgataccctggatgttgtcgcg 40583
>emb|CT573029.4| Medicago truncatula chromosome 3 clone MTH2-67H11, WORKING DRAFT
SEQUENCE
Length = 152401
Score = 50.1 bits (25), Expect = 3e-004
Identities = 46/53 (86%)
Strand = Plus / Minus
Query: 454 gcgtgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatctt 506
|||||||| ||||| ||||| || ||||||||||| ||||||| ||||||||
Sbjct: 69956 gcgtgctcagtgtatgtgaccgcatcacggatgacattctccaagaagatctt 69904
Score = 42.1 bits (21), Expect = 0.067
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 586 ggcttggtgatgccctggatgttgtcgcg 614
||||| ||||| |||||||||||||||||
Sbjct: 69824 ggcttagtgataccctggatgttgtcgcg 69796
>gb|BE239642.1|BE239642 EST403691 MHRP- Medicago truncatula cDNA clone pMHRP-28H24, mRNA
sequence
Length = 225
Score = 46.1 bits (23), Expect = 0.004
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 379 ccgaagccgtagagggtgcggccctgtcgcttgag 413
||||| ||||||||||| || ||||||||||||||
Sbjct: 43 ccgaaaccgtagagggtacgtccctgtcgcttgag 9
>gb|AJ389014.1|AJ389014 AJ389014 Medicago truncatula R108 Medicago truncatula cDNA clone
MtNo391 similar to histone H4, mRNA sequence
Length = 578
Score = 44.1 bits (22), Expect = 0.017
Identities = 43/50 (86%)
Strand = Plus / Minus
Query: 457 tgctcggtgtaggtgacggcgtcacggatgacgttctccagaaagatctt 506
||||| ||||| ||||| || ||||||||||| ||||||| ||||||||
Sbjct: 290 tgctcagtgtatgtgaccgcatcacggatgacattctccaagaagatctt 241
Score = 42.1 bits (21), Expect = 0.067
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 586 ggcttggtgatgccctggatgttgtcgcg 614
||||| ||||| |||||||||||||||||
Sbjct: 161 ggcttagtgataccctggatgttgtcgcg 133
>gb|AL380165.1|AL380165 MtBB50G12F1 MtBB Medicago truncatula cDNA clone MtBB50G12 T3, mRNA
sequence
Length = 479
Score = 44.1 bits (22), Expect = 0.017
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 586 ggcttggtgatgccctggatgttgtc 611
||||||||||| ||||||||||||||
Sbjct: 152 ggcttggtgataccctggatgttgtc 127
>gb|AL380166.1|AL380166 MtBB50G12R1 MtBB Medicago truncatula cDNA clone MtBB50G12 T7, mRNA
sequence
Length = 550
Score = 44.1 bits (22), Expect = 0.017
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 586 ggcttggtgatgccctggatgttgtc 611
||||||||||| ||||||||||||||
Sbjct: 150 ggcttggtgataccctggatgttgtc 125
>gb|AJ500970.1|AJ500970 AJ500970 MTAMP Medicago truncatula cDNA clone mtgmadc120001c03,
mRNA sequence
Length = 548
Score = 44.1 bits (22), Expect = 0.017
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 586 ggcttggtgatgccctggatgttgtc 611
||||||||||| ||||||||||||||
Sbjct: 192 ggcttggtgataccctggatgttgtc 167
>gb|AJ498812.1|AJ498812 AJ498812 MTPOSE Medicago truncatula cDNA clone mt--acc955208h12,
mRNA sequence
Length = 536
Score = 44.1 bits (22), Expect = 0.017
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 586 ggcttggtgatgccctggatgttgtc 611
||||||||||| ||||||||||||||
Sbjct: 178 ggcttggtgataccctggatgttgtc 153
>gb|AJ498978.1|AJ498978 AJ498978 MTPOSE Medicago truncatula cDNA clone mt--acc955210g06,
mRNA sequence
Length = 535
Score = 44.1 bits (22), Expect = 0.017
Identities = 25/26 (96%)
Strand = Plus / Minus
Query: 586 ggcttggtgatgccctggatgttgtc 611
||||||||||| ||||||||||||||
Sbjct: 177 ggcttggtgataccctggatgttgtc 152
>gb|AL366317.1|AL366317 MtBA06H01F1 MtBA Medicago truncatula cDNA clone MtBA06H01 T3, mRNA
sequence
Length = 176
Score = 42.1 bits (21), Expect = 0.067
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 580 atcgccggcttggtgatgccctggatgttgtcgcgca 616
||||| ||||| ||||| ||||||||||| |||||||
Sbjct: 110 atcgcaggctttgtgattccctggatgttatcgcgca 74
>gb|AC146561.22| Medicago truncatula clone mth2-12j18, complete sequence
Length = 135940
Score = 42.1 bits (21), Expect = 0.067
Identities = 21/21 (100%)
Strand = Plus / Plus
Query: 100 aaaataaaaattgcaatcaaa 120
|||||||||||||||||||||
Sbjct: 31148 aaaataaaaattgcaatcaaa 31168
>emb|CT573053.1| Medicago truncatula chromosome 5 clone mte1-8e5, COMPLETE SEQUENCE
Length = 106640
Score = 42.1 bits (21), Expect = 0.067
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 100 aaaataaaaattgcaatcaaa 120
|||||||||||||||||||||
Sbjct: 36482 aaaataaaaattgcaatcaaa 36462
>gb|AL379622.1|AL379622 MtBB46D08F1 MtBB Medicago truncatula cDNA clone MtBB46D08 T3, mRNA
sequence
Length = 313
Score = 40.1 bits (20), Expect = 0.27
Identities = 65/80 (81%)
Strand = Plus / Minus
Query: 580 atcgccggcttggtgatgccctggatgttgtcgcgcaggaccttgcggtggcgcttggcg 639
||||| ||||| || || |||||||||||||| || || ||||| || || ||||| ||
Sbjct: 147 atcgctggctttgttattccctggatgttgtcacgaagcaccttacgatgtcgctttgct 88
Query: 640 ccgcccttgcccagaccctt 659
|| ||||| |||| ||||||
Sbjct: 87 ccaccctttcccaaaccctt 68
>gb|AL379623.1|AL379623 MtBB46D08R1 MtBB Medicago truncatula cDNA clone MtBB46D08 T7, mRNA
sequence
Length = 490
Score = 40.1 bits (20), Expect = 0.27
Identities = 65/80 (81%)
Strand = Plus / Minus
Query: 580 atcgccggcttggtgatgccctggatgttgtcgcgcaggaccttgcggtggcgcttggcg 639
||||| ||||| || || |||||||||||||| || || ||||| || || ||||| ||
Sbjct: 90 atcgctggctttgttattccctggatgttgtcacgaagcaccttacgatgtcgctttgct 31
Query: 640 ccgcccttgcccagaccctt 659
|| ||||| |||| ||||||
Sbjct: 30 ccaccctttcccaaaccctt 11
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 160,190
Number of Sequences: 392609
Number of extensions: 160190
Number of successful extensions: 12575
Number of sequences better than 0.5: 53
Number of HSP's better than 0.5 without gapping: 53
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 12426
Number of HSP's gapped (non-prelim): 141
length of query: 761
length of database: 441,732,993
effective HSP length: 20
effective length of query: 741
effective length of database: 433,880,813
effective search space: 321505682433
effective search space used: 321505682433
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)