BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131543.2.11
(514 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AW329629.1|AW329629 N200889e rootphos(-) Medicago trunca... 125 4e-027
gb|AL377900.1|AL377900 MtBB34F10F1 MtBB Medicago truncatula... 125 4e-027
gb|AL377901.1|AL377901 MtBB34F10R1 MtBB Medicago truncatula... 125 4e-027
gb|AL381163.1|AL381163 MtBB57C08F1 MtBB Medicago truncatula... 125 4e-027
gb|AL381164.1|AL381164 MtBB57C08R1 MtBB Medicago truncatula... 125 4e-027
gb|AL388578.1|AL388578 MtBC49E02F1 MtBC Medicago truncatula... 125 4e-027
gb|BG457047.1|BG457047 NF069A08PL1F1055 Phosphate starved l... 125 4e-027
gb|BI264033.1|BI264033 NF113F02PL1F1027 Phosphate starved l... 125 4e-027
gb|BI264320.1|BI264320 NF118G02PL1F1020 Phosphate starved l... 125 4e-027
gb|BQ150120.1|BQ150120 NF008E07LF1F1054 Developing leaf Med... 125 4e-027
gb|CX520493.1|CX520493 s13dNF55D10VI080_448772 Virus-Infect... 125 4e-027
gb|CX539905.1|CX539905 s13dNF0FE08GS055_463082 Germinating ... 125 4e-027
gb|DW017375.1|DW017375 EST1226336 MTY Medicago truncatula c... 125 4e-027
gb|BI268734.1|BI268734 NF024G10GS1F1083 Germinating Seed Me... 119 2e-025
gb|BQ149926.1|BQ149926 NF040A09LF1F1066 Developing leaf Med... 117 9e-025
gb|AJ498678.1|AJ498678 AJ498678 MTPOSE Medicago truncatula ... 117 9e-025
gb|CX536563.1|CX536563 s13dNF24G10GS083_456300 Germinating ... 117 9e-025
gb|AL377934.1|AL377934 MtBB34H08F1 MtBB Medicago truncatula... 111 6e-023
gb|AL377935.1|AL377935 MtBB34H08R1 MtBB Medicago truncatula... 111 6e-023
gb|BQ150662.1|BQ150662 NF041F03LF1F1028 Developing leaf Med... 111 6e-023
gb|BG646768.1|BG646768 EST508387 HOGA Medicago truncatula c... 109 2e-022
gb|BI311882.1|BI311882 EST5313632 GESD Medicago truncatula ... 109 2e-022
gb|BI272910.1|BI272910 NF098H01FL1F1015 Developing flower M... 107 9e-022
gb|AJ497870.1|AJ497870 AJ497870 MTFLOW Medicago truncatula ... 103 1e-020
gb|CF068747.1|CF068747 EST669468 MTUS Medicago truncatula c... 103 1e-020
gb|AL388579.1|AL388579 MtBC49E02R1 MtBC Medicago truncatula... 92 5e-017
gb|BF634623.1|BF634623 NF061H06DT1F1059 Drought Medicago tr... 86 3e-015
gb|AC126780.18| Medicago truncatula clone mth2-10n4, comple... 86 3e-015
gb|BI309783.1|BI309783 EST5311533 GESD Medicago truncatula ... 66 3e-009
>gb|AW329629.1|AW329629 N200889e rootphos(-) Medicago truncatula cDNA clone MHRP-22D2, mRNA
sequence
Length = 369
Score = 125 bits (63), Expect = 4e-027
Identities = 132/155 (85%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||| ||||||||||| ||||| || ||||||||||| |||||||| |||||||| |||
Sbjct: 38 atggcgaagtcgaagaatcacactgctcacaaccagtcttacaaggctcacaagaatggc 97
Query: 174 atcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagttcctg 233
||||| ||||| ||| | || || || || ||||||||||||||||| || ||||| ||
Sbjct: 98 atcaaaaagccaaagaggcatcgccacacttccaccaaggggatggatccaaagtttttg 157
Query: 234 aggaacctgaggtattcaaggaagggcaacaagaa 268
||||||| ||||||| |||||||| |||||||||
Sbjct: 158 aggaaccagaggtatgcaaggaagcacaacaagaa 192
>gb|AL377900.1|AL377900 MtBB34F10F1 MtBB Medicago truncatula cDNA clone MtBB34F10 T3, mRNA
sequence
Length = 409
Score = 125 bits (63), Expect = 4e-027
Identities = 132/155 (85%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||| ||||||||||| ||||| || ||||||||||| |||||||| |||||||| |||
Sbjct: 37 atggcgaagtcgaagaatcacactgctcacaaccagtcttacaaggctcacaagaatggc 96
Query: 174 atcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagttcctg 233
||||| ||||| ||| | || || || || ||||||||||||||||| || ||||| ||
Sbjct: 97 atcaaaaagccaaagaggcatcgccacacttccaccaaggggatggatccaaagtttttg 156
Query: 234 aggaacctgaggtattcaaggaagggcaacaagaa 268
||||||| ||||||| |||||||| |||||||||
Sbjct: 157 aggaaccagaggtatgcaaggaagcacaacaagaa 191
>gb|AL377901.1|AL377901 MtBB34F10R1 MtBB Medicago truncatula cDNA clone MtBB34F10 T7, mRNA
sequence
Length = 430
Score = 125 bits (63), Expect = 4e-027
Identities = 132/155 (85%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||| ||||||||||| ||||| || ||||||||||| |||||||| |||||||| |||
Sbjct: 37 atggcgaagtcgaagaatcacactgctcacaaccagtcttacaaggctcacaagaatggc 96
Query: 174 atcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagttcctg 233
||||| ||||| ||| | || || || || ||||||||||||||||| || ||||| ||
Sbjct: 97 atcaaaaagccaaagaggcatcgccacacttccaccaaggggatggatccaaagtttttg 156
Query: 234 aggaacctgaggtattcaaggaagggcaacaagaa 268
||||||| ||||||| |||||||| |||||||||
Sbjct: 157 aggaaccagaggtatgcaaggaagcccaacaagaa 191
>gb|AL381163.1|AL381163 MtBB57C08F1 MtBB Medicago truncatula cDNA clone MtBB57C08 T3, mRNA
sequence
Length = 436
Score = 125 bits (63), Expect = 4e-027
Identities = 132/155 (85%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||| ||||||||||| ||||| || ||||||||||| |||||||| |||||||| |||
Sbjct: 36 atggcgaagtcgaagaatcacactgctcacaaccagtcttacaaggctcacaagaatggc 95
Query: 174 atcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagttcctg 233
||||| ||||| ||| | || || || || ||||||||||||||||| || ||||| ||
Sbjct: 96 atcaaaaagccaaagaggcatcgccacacttccaccaaggggatggatccaaagtttttg 155
Query: 234 aggaacctgaggtattcaaggaagggcaacaagaa 268
||||||| ||||||| |||||||| |||||||||
Sbjct: 156 aggaaccagaggtatgcaaggaagcacaacaagaa 190
>gb|AL381164.1|AL381164 MtBB57C08R1 MtBB Medicago truncatula cDNA clone MtBB57C08 T7, mRNA
sequence
Length = 458
Score = 125 bits (63), Expect = 4e-027
Identities = 132/155 (85%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||| ||||||||||| ||||| || ||||||||||| |||||||| |||||||| |||
Sbjct: 36 atggcgaagtcgaagaatcacactgctcacaaccagtcttacaaggctcacaagaatggc 95
Query: 174 atcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagttcctg 233
||||| ||||| ||| | || || || || ||||||||||||||||| || ||||| ||
Sbjct: 96 atcaaaaagccaaagaggcatcgccacacttccaccaaggggatggatccaaagtttttg 155
Query: 234 aggaacctgaggtattcaaggaagggcaacaagaa 268
||||||| ||||||| |||||||| |||||||||
Sbjct: 156 aggaaccagaggtatgcaaggaagcccaacaagaa 190
>gb|AL388578.1|AL388578 MtBC49E02F1 MtBC Medicago truncatula cDNA clone MtBC49E02 T3, mRNA
sequence
Length = 367
Score = 125 bits (63), Expect = 4e-027
Identities = 132/155 (85%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||| ||||||||||| ||||| || ||||||||||| |||||||| |||||||| |||
Sbjct: 38 atggcgaagtcgaagaatcacactgctcacaaccagtcttacaaggctcacaagaatggc 97
Query: 174 atcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagttcctg 233
||||| ||||| ||| | || || || || ||||||||||||||||| || ||||| ||
Sbjct: 98 atcaaaaagccaaagaggcatcgccacacttccaccaaggggatggatccaaagtttttg 157
Query: 234 aggaacctgaggtattcaaggaagggcaacaagaa 268
||||||| ||||||| |||||||| |||||||||
Sbjct: 158 aggaaccagaggtatgcaaggaagcacaacaagaa 192
>gb|BG457047.1|BG457047 NF069A08PL1F1055 Phosphate starved leaf Medicago truncatula cDNA
clone NF069A08PL 5', mRNA sequence
Length = 441
Score = 125 bits (63), Expect = 4e-027
Identities = 132/155 (85%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||| ||||||||||| ||||| || ||||||||||| |||||||| |||||||| |||
Sbjct: 45 atggcgaagtcgaagaatcacactgctcacaaccagtcttacaaggctcacaagaatggc 104
Query: 174 atcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagttcctg 233
||||| ||||| ||| | || || || || ||||||||||||||||| || ||||| ||
Sbjct: 105 atcaaaaagccaaagaggcatcgccacacttccaccaaggggatggatccaaagtttttg 164
Query: 234 aggaacctgaggtattcaaggaagggcaacaagaa 268
||||||| ||||||| |||||||| |||||||||
Sbjct: 165 aggaaccagaggtatgcaaggaagcacaacaagaa 199
>gb|BI264033.1|BI264033 NF113F02PL1F1027 Phosphate starved leaf Medicago truncatula cDNA
clone NF113F02PL 5', mRNA sequence
Length = 438
Score = 125 bits (63), Expect = 4e-027
Identities = 132/155 (85%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||| ||||||||||| ||||| || ||||||||||| |||||||| |||||||| |||
Sbjct: 39 atggcgaagtcgaagaatcacactgctcacaaccagtcttacaaggctcacaagaatggc 98
Query: 174 atcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagttcctg 233
||||| ||||| ||| | || || || || ||||||||||||||||| || ||||| ||
Sbjct: 99 atcaaaaagccaaagaggcatcgccacacttccaccaaggggatggatccaaagtttttg 158
Query: 234 aggaacctgaggtattcaaggaagggcaacaagaa 268
||||||| ||||||| |||||||| |||||||||
Sbjct: 159 aggaaccagaggtatgcaaggaagcacaacaagaa 193
>gb|BI264320.1|BI264320 NF118G02PL1F1020 Phosphate starved leaf Medicago truncatula cDNA
clone NF118G02PL 5', mRNA sequence
Length = 424
Score = 125 bits (63), Expect = 4e-027
Identities = 132/155 (85%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||| ||||||||||| ||||| || ||||||||||| |||||||| |||||||| |||
Sbjct: 45 atggcgaagtcgaagaatcacactgctcacaaccagtcttacaaggctcacaagaatggc 104
Query: 174 atcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagttcctg 233
||||| ||||| ||| | || || || || ||||||||||||||||| || ||||| ||
Sbjct: 105 atcaaaaagccaaagaggcatcgccacacttccaccaaggggatggatccaaagtttttg 164
Query: 234 aggaacctgaggtattcaaggaagggcaacaagaa 268
||||||| ||||||| |||||||| |||||||||
Sbjct: 165 aggaaccagaggtatgcaaggaagcacaacaagaa 199
>gb|BQ150120.1|BQ150120 NF008E07LF1F1054 Developing leaf Medicago truncatula cDNA clone
NF008E07LF 5', mRNA sequence
Length = 801
Score = 125 bits (63), Expect = 4e-027
Identities = 132/155 (85%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||| ||||||||||| ||||| || ||||||||||| |||||||| |||||||| |||
Sbjct: 149 atggcgaagtcgaagaatcacactgctcacaaccagtcttacaaggctcacaagaatggc 208
Query: 174 atcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagttcctg 233
||||| ||||| ||| | || || || || ||||||||||||||||| || ||||| ||
Sbjct: 209 atcaaaaagccaaagaggcatcgccacacttccaccaaggggatggatccaaagtttttg 268
Query: 234 aggaacctgaggtattcaaggaagggcaacaagaa 268
||||||| ||||||| |||||||| |||||||||
Sbjct: 269 aggaaccagaggtatgcaaggaagcacaacaagaa 303
>gb|CX520493.1|CX520493 s13dNF55D10VI080_448772 Virus-Infected Leaves Medicago truncatula
cDNA, mRNA sequence
Length = 421
Score = 125 bits (63), Expect = 4e-027
Identities = 132/155 (85%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||| ||||||||||| ||||| || ||||||||||| |||||||| |||||||| |||
Sbjct: 40 atggcgaagtcgaagaatcacactgctcacaaccagtcttacaaggctcacaagaatggc 99
Query: 174 atcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagttcctg 233
||||| ||||| ||| | || || || || ||||||||||||||||| || ||||| ||
Sbjct: 100 atcaaaaagccaaagaggcatcgccacacttccaccaaggggatggatccaaagtttttg 159
Query: 234 aggaacctgaggtattcaaggaagggcaacaagaa 268
||||||| ||||||| |||||||| |||||||||
Sbjct: 160 aggaaccagaggtatgcaaggaagcacaacaagaa 194
>gb|CX539905.1|CX539905 s13dNF0FE08GS055_463082 Germinating Seed Medicago truncatula cDNA,
mRNA sequence
Length = 418
Score = 125 bits (63), Expect = 4e-027
Identities = 132/155 (85%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||| ||||||||||| ||||| || ||||||||||| |||||||| |||||||| |||
Sbjct: 37 atggcgaagtcgaagaatcacactgctcacaaccagtcttacaaggctcacaagaatggc 96
Query: 174 atcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagttcctg 233
||||| ||||| ||| | || || || || ||||||||||||||||| || ||||| ||
Sbjct: 97 atcaaaaagccaaagaggcatcgccacacttccaccaaggggatggatccaaagtttttg 156
Query: 234 aggaacctgaggtattcaaggaagggcaacaagaa 268
||||||| ||||||| |||||||| |||||||||
Sbjct: 157 aggaaccagaggtatgcaaggaagcacaacaagaa 191
>gb|DW017375.1|DW017375 EST1226336 MTY Medicago truncatula cDNA clone MTYAS84, mRNA
sequence
Length = 396
Score = 125 bits (63), Expect = 4e-027
Identities = 132/155 (85%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||| ||||||||||| ||||| || ||||||||||| |||||||| |||||||| |||
Sbjct: 57 atggcgaagtcgaagaatcacactgctcacaaccagtcttacaaggctcacaagaatggc 116
Query: 174 atcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagttcctg 233
||||| ||||| ||| | || || || || ||||||||||||||||| || ||||| ||
Sbjct: 117 atcaaaaagccaaagaggcatcgccacacttccaccaaggggatggatccaaagtttttg 176
Query: 234 aggaacctgaggtattcaaggaagggcaacaagaa 268
||||||| ||||||| |||||||| |||||||||
Sbjct: 177 aggaaccagaggtatgcaaggaagcacaacaagaa 211
>gb|BI268734.1|BI268734 NF024G10GS1F1083 Germinating Seed Medicago truncatula cDNA clone
NF024G10GS 5', mRNA sequence
Length = 435
Score = 119 bits (60), Expect = 2e-025
Identities = 131/155 (84%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||| ||||||||||| ||||| || ||||||||||| |||||||| |||||||| |||
Sbjct: 20 atggcgaagtcgaagaatcacactgctcacaaccagtcttacaaggctcacaagaatggc 79
Query: 174 atcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagttcctg 233
||||| ||||| ||| | | || || || ||||||||||||||||| || ||||| ||
Sbjct: 80 atcaaaaagccaaagaggcntcgccacacttccaccaaggggatggatccaaagtttttg 139
Query: 234 aggaacctgaggtattcaaggaagggcaacaagaa 268
||||||| ||||||| |||||||| |||||||||
Sbjct: 140 aggaaccagaggtatgcaaggaagcacaacaagaa 174
>gb|BQ149926.1|BQ149926 NF040A09LF1F1066 Developing leaf Medicago truncatula cDNA clone
NF040A09LF 5', mRNA sequence
Length = 873
Score = 117 bits (59), Expect = 9e-025
Identities = 131/155 (84%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||| ||||||||||| ||||| || ||||||||||| |||||||| |||||||| |||
Sbjct: 150 atggcgaagtcgaagaatcacactgctcacaaccagtcttacaaggctcacaagaatggc 209
Query: 174 atcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagttcctg 233
||||| ||||| ||| | || | || || ||||||||||||||||| || ||||| ||
Sbjct: 210 atcaaaaagccaaagaggcatctccacacttccaccaaggggatggatccaaagtttttg 269
Query: 234 aggaacctgaggtattcaaggaagggcaacaagaa 268
||||||| ||||||| |||||||| |||||||||
Sbjct: 270 aggaaccagaggtatgcaaggaagcacaacaagaa 304
>gb|AJ498678.1|AJ498678 AJ498678 MTPOSE Medicago truncatula cDNA clone mt--acc955207d11,
mRNA sequence
Length = 436
Score = 117 bits (59), Expect = 9e-025
Identities = 131/155 (84%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||| ||||||||||| ||||| || ||||||||||| |||||||| |||||||| |||
Sbjct: 60 atggcgaagtcgaagaatcacactgctcacaaccagtcttacaaggctcacaagaatggc 119
Query: 174 atcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagttcctg 233
|||| ||||| ||| | || || || || ||||||||||||||||| || ||||| ||
Sbjct: 120 gtcaaaaagccaaagaggcatcgccacacttccaccaaggggatggatccaaagtttttg 179
Query: 234 aggaacctgaggtattcaaggaagggcaacaagaa 268
||||||| ||||||| |||||||| |||||||||
Sbjct: 180 aggaaccagaggtatgcaaggaagcacaacaagaa 214
>gb|CX536563.1|CX536563 s13dNF24G10GS083_456300 Germinating Seed Medicago truncatula cDNA,
mRNA sequence
Length = 426
Score = 117 bits (59), Expect = 9e-025
Identities = 131/155 (84%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||| ||||||||||| ||||| || ||||||||||| |||||||| |||||||| |||
Sbjct: 45 atggcgaagtcgaagaatcacactgctcacaaccagtcttacaaggctcacaagaatggc 104
Query: 174 atcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagttcctg 233
||||| ||||| ||| | | || || || ||||||||||||||||| || ||||| ||
Sbjct: 105 atcaaaaagccaaagaggcgtcgccacacttccaccaaggggatggatccaaagtttttg 164
Query: 234 aggaacctgaggtattcaaggaagggcaacaagaa 268
||||||| ||||||| |||||||| |||||||||
Sbjct: 165 aggaaccagaggtatgcaaggaagcacaacaagaa 199
>gb|AL377934.1|AL377934 MtBB34H08F1 MtBB Medicago truncatula cDNA clone MtBB34H08 T3, mRNA
sequence
Length = 308
Score = 111 bits (56), Expect = 6e-023
Identities = 125/148 (84%)
Strand = Plus / Plus
Query: 110 agagatggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaa 169
||||||||| ||||||||||| ||||| || ||||||||||| |||||||| ||||| ||
Sbjct: 22 agagatggcaaagtcgaagaatcacaccgctcacaaccagtcttacaaggcccacaaaaa 81
Query: 170 cggcatcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagtt 229
|||||||||||||| ||| | || || || || |||||||| |||||||| || |||||
Sbjct: 82 tggcatcaagaagccaaagaggcatcgccacacttccaccaaagggatggatccaaagtt 141
Query: 230 cctgaggaacctgaggtattcaaggaag 257
||||||||| |||||| ||||||||
Sbjct: 142 tttgaggaaccagaggtacgcaaggaag 169
>gb|AL377935.1|AL377935 MtBB34H08R1 MtBB Medicago truncatula cDNA clone MtBB34H08 T7, mRNA
sequence
Length = 343
Score = 111 bits (56), Expect = 6e-023
Identities = 125/148 (84%)
Strand = Plus / Plus
Query: 110 agagatggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaa 169
||||||||| ||||||||||| ||||| || ||||||||||| |||||||| ||||| ||
Sbjct: 26 agagatggcaaagtcgaagaatcacaccgctcacaaccagtcttacaaggcccacaaaaa 85
Query: 170 cggcatcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagtt 229
|||||||||||||| ||| | || || || || |||||||| |||||||| || |||||
Sbjct: 86 tggcatcaagaagccaaagaggcatcgccacacttccaccaaagggatggatccaaagtt 145
Query: 230 cctgaggaacctgaggtattcaaggaag 257
||||||||| |||||| ||||||||
Sbjct: 146 tttgaggaaccagaggtacgcaaggaag 173
>gb|BQ150662.1|BQ150662 NF041F03LF1F1028 Developing leaf Medicago truncatula cDNA clone
NF041F03LF 5', mRNA sequence
Length = 836
Score = 111 bits (56), Expect = 6e-023
Identities = 132/156 (84%), Gaps = 1/156 (0%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccaca-cggcgcacaaccagtcgtacaaggcgcacaagaacgg 172
||||| ||||||||||| |||| | || ||||||||||| |||||||| |||||||| ||
Sbjct: 151 atggcgaagtcgaagaatcacatctgctcacaaccagtcttacaaggctcacaagaatgg 210
Query: 173 catcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagttcct 232
|||||| ||||| ||| | || || || || ||||||||||||||||| || ||||| |
Sbjct: 211 catcaaaaagccaaagaggcatcgccacacttccaccaaggggatggatccaaagttttt 270
Query: 233 gaggaacctgaggtattcaaggaagggcaacaagaa 268
|||||||| ||||||| |||||||| |||||||||
Sbjct: 271 gaggaaccagaggtatgcaaggaagcacaacaagaa 306
>gb|BG646768.1|BG646768 EST508387 HOGA Medicago truncatula cDNA clone pHOGA-9B24 5' end,
mRNA sequence
Length = 404
Score = 109 bits (55), Expect = 2e-022
Identities = 131/155 (84%), Gaps = 1/155 (0%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||| ||||||||||| | ||| || ||||||||||| |||||||| |||||||| |||
Sbjct: 24 atggcgaagtcgaagaatc-cactgctcacaaccagtcttacaaggctcacaagaatggc 82
Query: 174 atcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagttcctg 233
||||| ||||| ||| | || || || || ||||||||||||||||| || ||||| ||
Sbjct: 83 atcaaaaagccaaagaggcatcgccacacttccaccaaggggatggatccaaagtttttg 142
Query: 234 aggaacctgaggtattcaaggaagggcaacaagaa 268
||||||| ||||||| |||||||| |||||||||
Sbjct: 143 aggaaccagaggtatgcaaggaagcacaacaagaa 177
>gb|BI311882.1|BI311882 EST5313632 GESD Medicago truncatula cDNA clone pGESD15D16 5' end,
mRNA sequence
Length = 409
Score = 109 bits (55), Expect = 2e-022
Identities = 131/155 (84%), Gaps = 1/155 (0%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||| ||||||||||| |||| || ||||||||||| |||||||| |||||||| |||
Sbjct: 32 atggcgaagtcgaagaat-acactgctcacaaccagtcttacaaggctcacaagaatggc 90
Query: 174 atcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagttcctg 233
||||| ||||| ||| | || || || || ||||||||||||||||| || ||||| ||
Sbjct: 91 atcaaaaagccaaagaggcatcgccacacttccaccaaggggatggatccaaagtttttg 150
Query: 234 aggaacctgaggtattcaaggaagggcaacaagaa 268
||||||| ||||||| |||||||| |||||||||
Sbjct: 151 aggaaccagaggtatgcaaggaagcacaacaagaa 185
>gb|BI272910.1|BI272910 NF098H01FL1F1015 Developing flower Medicago truncatula cDNA clone
NF098H01FL 5', mRNA sequence
Length = 260
Score = 107 bits (54), Expect = 9e-022
Identities = 122/145 (84%)
Strand = Plus / Plus
Query: 124 cgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggcatcaagaagc 183
||||||| ||||| || ||||||||||| |||||||| |||||||| |||||||| ||||
Sbjct: 51 cgaagaatcacactgctcacaaccagtcttacaaggctcacaagaatggcatcaaaaagc 110
Query: 184 ccaagcgccaccggcagacctccaccaaggggatggaccccaagttcctgaggaacctga 243
| ||| | || || || || ||||||||||||||||| || ||||| ||||||||| |
Sbjct: 111 caaagaggcatcgccacacttccaccaaggggatggatccaaagtttttgaggaaccana 170
Query: 244 ggtattcaaggaagggcaacaagaa 268
||||| |||||||| |||||||||
Sbjct: 171 ggtatgcaaggaagcacaacaagaa 195
>gb|AJ497870.1|AJ497870 AJ497870 MTFLOW Medicago truncatula cDNA clone mt--abc955115f03,
mRNA sequence
Length = 369
Score = 103 bits (52), Expect = 1e-020
Identities = 109/128 (85%)
Strand = Plus / Plus
Query: 141 cacaaccagtcgtacaaggcgcacaagaacggcatcaagaagcccaagcgccaccggcag 200
||||||||||| |||||||| |||||||| |||||||| ||||| ||| | || || ||
Sbjct: 15 cacaaccagtcttacaaggctcacaagaatggcatcaaaaagccaaagaggcatcgccac 74
Query: 201 acctccaccaaggggatggaccccaagttcctgaggaacctgaggtattcaaggaagggc 260
|| ||||||||||||||||| || ||||| ||||||||| ||||||| |||||||| |
Sbjct: 75 acttccaccaaggggatggatccaaagtttttgaggaaccagaggtatgcaaggaagcac 134
Query: 261 aacaagaa 268
||||||||
Sbjct: 135 aacaagaa 142
>gb|CF068747.1|CF068747 EST669468 MTUS Medicago truncatula cDNA clone MTUS-12A1, mRNA
sequence
Length = 367
Score = 103 bits (52), Expect = 1e-020
Identities = 109/128 (85%)
Strand = Plus / Plus
Query: 141 cacaaccagtcgtacaaggcgcacaagaacggcatcaagaagcccaagcgccaccggcag 200
||||||||||| |||||||| |||||||| |||||||| ||||| ||| | || || ||
Sbjct: 16 cacaaccagtcttacaaggctcacaagaatggcatcaaaaagccaaagaggcatcgccac 75
Query: 201 acctccaccaaggggatggaccccaagttcctgaggaacctgaggtattcaaggaagggc 260
|| ||||||||||||||||| || ||||| ||||||||| ||||||| |||||||| |
Sbjct: 76 acttccaccaaggggatggatccaaagtttttgaggaaccagaggtatgcaaggaagcac 135
Query: 261 aacaagaa 268
||||||||
Sbjct: 136 aacaagaa 143
>gb|AL388579.1|AL388579 MtBC49E02R1 MtBC Medicago truncatula cDNA clone MtBC49E02 T7, mRNA
sequence
Length = 390
Score = 91.7 bits (46), Expect = 5e-017
Identities = 103/122 (84%)
Strand = Plus / Plus
Query: 147 cagtcgtacaaggcgcacaagaacggcatcaagaagcccaagcgccaccggcagacctcc 206
||||| |||||||| |||||||| |||||||| ||||| ||| | || || || || |||
Sbjct: 80 cagtcttacaaggctcacaagaatggcatcaaaaagccaaagaggcatcgccacacttcc 139
Query: 207 accaaggggatggaccccaagttcctgaggaacctgaggtattcaaggaagggcaacaag 266
|||||||||||||| || ||||| ||||||||| ||||||| |||||||| |||||||
Sbjct: 140 accaaggggatggatccaaagtttttgaggaaccagaggtatgcaaggaagcacaacaag 199
Query: 267 aa 268
||
Sbjct: 200 aa 201
>gb|BF634623.1|BF634623 NF061H06DT1F1059 Drought Medicago truncatula cDNA clone NF061H06DT
5', mRNA sequence
Length = 458
Score = 85.7 bits (43), Expect = 3e-015
Identities = 64/71 (90%)
Strand = Plus / Plus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||||||||| ||||| |||||||| || |||||| |||||||| |||||||||||||
Sbjct: 24 atggccaagtcaaagaatcacacggctcataaccagacgtacaagtggcacaagaacggc 83
Query: 174 atcaagaagcc 184
|||||||||||
Sbjct: 84 atcaagaagcc 94
Score = 46.1 bits (23), Expect = 0.003
Identities = 29/31 (93%)
Strand = Plus / Plus
Query: 210 aaggggatggaccccaagttcctgaggaacc 240
||||||||||| ||||||||||| |||||||
Sbjct: 120 aaggggatggatcccaagttcctcaggaacc 150
>gb|AC126780.18| Medicago truncatula clone mth2-10n4, complete sequence
Length = 139213
Score = 85.7 bits (43), Expect = 3e-015
Identities = 67/75 (89%)
Strand = Plus / Minus
Query: 110 agagatggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaa 169
||||||||| ||||||||||| ||||| || ||||||||||| |||||||| ||||| ||
Sbjct: 109665 agagatggcaaagtcgaagaatcacaccgctcacaaccagtcttacaaggcccacaaaaa 109606
Query: 170 cggcatcaagaagcc 184
||||||||||||||
Sbjct: 109605 tggcatcaagaagcc 109591
Score = 83.8 bits (42), Expect = 1e-014
Identities = 87/102 (85%)
Strand = Plus / Minus
Query: 114 atggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaacggc 173
||||| ||||||||||| ||||| || ||||||||||| |||||||| |||||||| |||
Sbjct: 114008 atggcgaagtcgaagaatcacactgctcacaaccagtcttacaaggctcacaagaatggc 113949
Query: 174 atcaagaagcccaagcgccaccggcagacctccaccaagggg 215
||||| ||||| ||| | || || || || ||||||||||||
Sbjct: 113948 atcaaaaagccaaagaggcatcgccacacttccaccaagggg 113907
>gb|BI309783.1|BI309783 EST5311533 GESD Medicago truncatula cDNA clone pGESD4I15 5' end,
mRNA sequence
Length = 242
Score = 65.9 bits (33), Expect = 3e-009
Identities = 57/65 (87%)
Strand = Plus / Plus
Query: 204 tccaccaaggggatggaccccaagttcctgaggaacctgaggtattcaaggaagggcaac 263
||||||||||||||||| || ||||| ||||||||| ||||||| |||||||| ||||
Sbjct: 23 tccaccaaggggatggatccaaagtttttgaggaaccagaggtatgcaaggaagcacaac 82
Query: 264 aagaa 268
|||||
Sbjct: 83 aagaa 87
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 132,258
Number of Sequences: 392609
Number of extensions: 132258
Number of successful extensions: 11063
Number of sequences better than 0.5: 29
Number of HSP's better than 0.5 without gapping: 29
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 11022
Number of HSP's gapped (non-prelim): 36
length of query: 514
length of database: 441,732,993
effective HSP length: 19
effective length of query: 495
effective length of database: 434,273,422
effective search space: 214965343890
effective search space used: 214965343890
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)