BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.78
(943 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AL373908.1|AL373908 MtBB03E08F1 MtBB Medicago truncatula... 48 0.001
gb|BF637655.1|BF637655 NF032B07PL1F1059 Phosphate starved l... 48 0.001
gb|CX524368.1|CX524368 s13dNF15A03AT017_448080 Aphid-Infect... 48 0.001
gb|DW017022.1|DW017022 EST1225983 MTY Medicago truncatula c... 48 0.001
gb|AC134242.17| Medicago truncatula clone mth2-10p20, compl... 48 0.001
gb|AJ848597.1|AJ848597 AJ848597 MtSN4 Medicago truncatula c... 46 0.005
gb|AJ388692.1|AJ388692 AJ388692 Medicago truncatula R108 Me... 40 0.33
gb|AW267758.1|AW267758 EST305886 DSIR Medicago truncatula c... 40 0.33
gb|AW559786.1|AW559786 EST314834 DSIR Medicago truncatula c... 40 0.33
gb|AW775786.1|AW775786 EST334851 DSIL Medicago truncatula c... 40 0.33
gb|BE187600.1|BE187600 EST336161 KV0 Medicago truncatula cD... 40 0.33
gb|BE203378.1|BE203378 EST403400 KV1 Medicago truncatula cD... 40 0.33
gb|AL365942.1|AL365942 MtBA03C11F2 MtBA Medicago truncatula... 40 0.33
gb|AL368756.1|AL368756 MtBA26E07F1 MtBA Medicago truncatula... 40 0.33
gb|AL368801.1|AL368801 MtBA26H04F1 MtBA Medicago truncatula... 40 0.33
gb|AL370487.1|AL370487 MtBA38B04F1 MtBA Medicago truncatula... 40 0.33
gb|AL371197.1|AL371197 MtBA42E06F1 MtBA Medicago truncatula... 40 0.33
gb|AL374421.1|AL374421 MtBB06E05F1 MtBB Medicago truncatula... 40 0.33
gb|AL375736.1|AL375736 MtBB16F12F1 MtBB Medicago truncatula... 40 0.33
gb|AL377345.1|AL377345 MtBB30H09F1 MtBB Medicago truncatula... 40 0.33
gb|AL378912.1|AL378912 MtBB41C05F1 MtBB Medicago truncatula... 40 0.33
gb|BF520355.1|BF520355 EST457825 DSIL Medicago truncatula c... 40 0.33
gb|BF521377.1|BF521377 EST458853 DSIL Medicago truncatula c... 40 0.33
gb|BF637060.1|BF637060 NF050A11LF1F1082 Developing leaf Med... 40 0.33
gb|BF638341.1|BF638341 NF054H06PL1F1058 Phosphate starved l... 40 0.33
gb|BF646591.1|BF646591 NF078E02EC1F1018 Elicited cell cultu... 40 0.33
gb|AW686242.2|AW686242 NF039F07NR1F1000 Nodulated root Medi... 40 0.33
gb|AW685732.2|AW685732 NF034F02NR1F1000 Nodulated root Medi... 40 0.33
gb|AW692987.2|AW692987 NF061F09ST1F1000 Developing stem Med... 40 0.33
gb|BE318585.2|BE318585 NF041F04LF1F1032 Developing leaf Med... 40 0.33
gb|BE315863.2|BE315863 NF027C03LF1F1018 Developing leaf Med... 40 0.33
gb|BE317627.2|BE317627 NF054C12LF1F1086 Developing leaf Med... 40 0.33
gb|BE316289.2|BE316289 NF032C01LF1F1002 Developing leaf Med... 40 0.33
gb|BE318077.2|BE318077 NF062C09LF1F1066 Developing leaf Med... 40 0.33
gb|BE318120.2|BE318120 NF062G11LF1F1084 Developing leaf Med... 40 0.33
gb|BG448975.1|BG448975 NF003H12IN1F1104 Insect herbivory Me... 40 0.33
gb|BG581855.1|BG581855 EST483591 GVN Medicago truncatula cD... 40 0.33
gb|BI263903.1|BI263903 NF092C05PL1F1038 Phosphate starved l... 40 0.33
gb|BI309824.1|BI309824 EST5311574 GESD Medicago truncatula ... 40 0.33
gb|BQ139506.1|BQ139506 NF021A04PH1F1024 Phoma-infected Medi... 40 0.33
gb|AJ502053.1|AJ502053 AJ502053 MTAMP Medicago truncatula c... 40 0.33
gb|CA919363.1|CA919363 EST637081 MTUS Medicago truncatula c... 40 0.33
gb|CA921752.1|CA921752 EST639470 MTUS Medicago truncatula c... 40 0.33
gb|CF068801.1|CF068801 EST669522 MTUS Medicago truncatula c... 40 0.33
gb|AJ846513.1|AJ846513 AJ846513 MtSCF Medicago truncatula c... 40 0.33
gb|AJ847287.1|AJ847287 AJ847287 MtSTW Medicago truncatula c... 40 0.33
gb|CX524027.1|CX524027 s13dNF12G08AT056_447398 Aphid-Infect... 40 0.33
gb|CX525585.1|CX525585 s13dNF24G05AT040_479804 Aphid-Infect... 40 0.33
gb|CX525951.1|CX525951 s13dNF32F09AT079_509646 Aphid-Infect... 40 0.33
gb|CX526843.1|CX526843 s13dNF27C03AT022_514198 Aphid-Infect... 40 0.33
gb|CX528345.1|CX528345 s13dNF54D07AT062_517202 Aphid-Infect... 40 0.33
gb|CX532721.1|CX532721 s13dNF48A10MJ069_271725 Methyl Jasmo... 40 0.33
gb|CX534484.1|CX534484 s13dNF76F08MJ063_328564 Methyl Jasmo... 40 0.33
gb|CX539416.1|CX539416 s13dNF70G01GS004_462092 Germinating ... 40 0.33
gb|CX540470.1|CX540470 s13dNF49F08GS063_464216 Germinating ... 40 0.33
gb|CX540751.1|CX540751 s13dNF56D06GS058_464780 Germinating ... 40 0.33
>gb|AL373908.1|AL373908 MtBB03E08F1 MtBB Medicago truncatula cDNA clone MtBB03E08 T3, mRNA
sequence
Length = 327
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||||||||||||
Sbjct: 51 gtggcccatgcaagacctccgacgaagcaacggtactcaacatc 8
>gb|BF637655.1|BF637655 NF032B07PL1F1059 Phosphate starved leaf Medicago truncatula cDNA
clone NF032B07PL 5', mRNA sequence
Length = 432
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||||||||||||
Sbjct: 85 gtggcccatgcaagacctccgacgaagcaacggtactcaacatc 42
>gb|CX524368.1|CX524368 s13dNF15A03AT017_448080 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 415
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||||||||||||
Sbjct: 94 gtggcccatgcaagacctccgacgaagcaacggtactcaacatc 51
>gb|DW017022.1|DW017022 EST1225983 MTY Medicago truncatula cDNA clone MTYAO52, mRNA
sequence
Length = 792
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||||||||||||
Sbjct: 116 gtggcccatgcaagacctccgacgaagcaacggtactcaacatc 73
>gb|AC134242.17| Medicago truncatula clone mth2-10p20, complete sequence
Length = 115005
Score = 48.1 bits (24), Expect = 0.001
Identities = 39/44 (88%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||||||||||||
Sbjct: 57897 gtggcccatgcaagacctccgacgaagcaacggtactcaacatc 57854
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 75130 gtggcccatgcaagacctccgacgaagcaacggtattcaacatc 75087
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 30829 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 30786
>gb|AJ848597.1|AJ848597 AJ848597 MtSN4 Medicago truncatula cDNA clone MtN409H24N1, mRNA
sequence
Length = 613
Score = 46.1 bits (23), Expect = 0.005
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacat 827
|||||||| || || || ||||||||||||||||| |||||||
Sbjct: 64 gtggcccatgcaagacctccgacgaagcagcggtattcaacat 22
>gb|AJ388692.1|AJ388692 AJ388692 Medicago truncatula R108 Medicago truncatula cDNA clone
MtNo051 similar to glycine-rich RNA binding protein,
mRNA sequence
Length = 503
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 100 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 57
>gb|AW267758.1|AW267758 EST305886 DSIR Medicago truncatula cDNA clone pDSIR-7O5, mRNA
sequence
Length = 375
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 93 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 50
>gb|AW559786.1|AW559786 EST314834 DSIR Medicago truncatula cDNA clone pDSIR-24B2, mRNA
sequence
Length = 331
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 109 gtggcccatgcaagacctccgacgaagcaccggtaatcaacatc 66
>gb|AW775786.1|AW775786 EST334851 DSIL Medicago truncatula cDNA clone pDSIL-3K7, mRNA
sequence
Length = 606
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 62 gtggcccatgcaagacctccgacgaagcaacggtattcaacatc 19
>gb|BE187600.1|BE187600 EST336161 KV0 Medicago truncatula cDNA clone pKV0-16E11, mRNA
sequence
Length = 499
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 67 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 24
>gb|BE203378.1|BE203378 EST403400 KV1 Medicago truncatula cDNA clone pKV1-5G8, mRNA
sequence
Length = 397
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 87 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 44
>gb|AL365942.1|AL365942 MtBA03C11F2 MtBA Medicago truncatula cDNA clone MtBA03C11 T3, mRNA
sequence
Length = 341
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 93 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 50
>gb|AL368756.1|AL368756 MtBA26E07F1 MtBA Medicago truncatula cDNA clone MtBA26E07 T3, mRNA
sequence
Length = 372
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 102 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 59
>gb|AL368801.1|AL368801 MtBA26H04F1 MtBA Medicago truncatula cDNA clone MtBA26H04 T3, mRNA
sequence
Length = 316
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 92 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 49
>gb|AL370487.1|AL370487 MtBA38B04F1 MtBA Medicago truncatula cDNA clone MtBA38B04 T3, mRNA
sequence
Length = 302
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 77 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 34
>gb|AL371197.1|AL371197 MtBA42E06F1 MtBA Medicago truncatula cDNA clone MtBA42E06 T3, mRNA
sequence
Length = 464
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 92 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 49
>gb|AL374421.1|AL374421 MtBB06E05F1 MtBB Medicago truncatula cDNA clone MtBB06E05 T3, mRNA
sequence
Length = 310
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 48 gtggcccatgcaagacctccgacgaagcaacggtattcaacatc 5
>gb|AL375736.1|AL375736 MtBB16F12F1 MtBB Medicago truncatula cDNA clone MtBB16F12 T3, mRNA
sequence
Length = 291
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 76 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 33
>gb|AL377345.1|AL377345 MtBB30H09F1 MtBB Medicago truncatula cDNA clone MtBB30H09 T3, mRNA
sequence
Length = 334
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 90 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 47
>gb|AL378912.1|AL378912 MtBB41C05F1 MtBB Medicago truncatula cDNA clone MtBB41C05 T3, mRNA
sequence
Length = 245
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 76 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 33
>gb|BF520355.1|BF520355 EST457825 DSIL Medicago truncatula cDNA clone pDSIL-23K4, mRNA
sequence
Length = 364
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 82 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 39
>gb|BF521377.1|BF521377 EST458853 DSIL Medicago truncatula cDNA clone pDSIL-43O21, mRNA
sequence
Length = 409
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 81 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 38
>gb|BF637060.1|BF637060 NF050A11LF1F1082 Developing leaf Medicago truncatula cDNA clone
NF050A11LF 5', mRNA sequence
Length = 418
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 108 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 65
>gb|BF638341.1|BF638341 NF054H06PL1F1058 Phosphate starved leaf Medicago truncatula cDNA
clone NF054H06PL 5', mRNA sequence
Length = 445
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 106 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 63
>gb|BF646591.1|BF646591 NF078E02EC1F1018 Elicited cell culture Medicago truncatula cDNA
clone NF078E02EC 5', mRNA sequence
Length = 380
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 100 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 57
>gb|AW686242.2|AW686242 NF039F07NR1F1000 Nodulated root Medicago truncatula cDNA clone
NF039F07NR 5', mRNA sequence
Length = 416
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 101 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 58
>gb|AW685732.2|AW685732 NF034F02NR1F1000 Nodulated root Medicago truncatula cDNA clone
NF034F02NR 5', mRNA sequence
Length = 583
Score = 40.1 bits (20), Expect = 0.33
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 94 ttttgcagcaccaagaagca 113
||||||||||||||||||||
Sbjct: 522 ttttgcagcaccaagaagca 503
>gb|AW692987.2|AW692987 NF061F09ST1F1000 Developing stem Medicago truncatula cDNA clone
NF061F09ST 5', mRNA sequence
Length = 424
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 105 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 62
>gb|BE318585.2|BE318585 NF041F04LF1F1032 Developing leaf Medicago truncatula cDNA clone
NF041F04LF 5', mRNA sequence
Length = 373
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 109 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 66
>gb|BE315863.2|BE315863 NF027C03LF1F1018 Developing leaf Medicago truncatula cDNA clone
NF027C03LF 5', mRNA sequence
Length = 271
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 93 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 50
>gb|BE317627.2|BE317627 NF054C12LF1F1086 Developing leaf Medicago truncatula cDNA clone
NF054C12LF 5', mRNA sequence
Length = 333
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 108 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 65
>gb|BE316289.2|BE316289 NF032C01LF1F1002 Developing leaf Medicago truncatula cDNA clone
NF032C01LF 5', mRNA sequence
Length = 353
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 93 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 50
>gb|BE318077.2|BE318077 NF062C09LF1F1066 Developing leaf Medicago truncatula cDNA clone
NF062C09LF 5', mRNA sequence
Length = 326
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 105 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 62
>gb|BE318120.2|BE318120 NF062G11LF1F1084 Developing leaf Medicago truncatula cDNA clone
NF062G11LF 5', mRNA sequence
Length = 321
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 93 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 50
>gb|BG448975.1|BG448975 NF003H12IN1F1104 Insect herbivory Medicago truncatula cDNA clone
NF003H12IN 5', mRNA sequence
Length = 393
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 78 gtggcccatgcaagacctccgacgaagcaacggtattcaacatc 35
>gb|BG581855.1|BG581855 EST483591 GVN Medicago truncatula cDNA clone pGVN-66E19 5' end,
mRNA sequence
Length = 529
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 100 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 57
>gb|BI263903.1|BI263903 NF092C05PL1F1038 Phosphate starved leaf Medicago truncatula cDNA
clone NF092C05PL 5', mRNA sequence
Length = 393
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 87 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 44
>gb|BI309824.1|BI309824 EST5311574 GESD Medicago truncatula cDNA clone pGESD4C2 5' end,
mRNA sequence
Length = 531
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 107 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 64
>gb|BQ139506.1|BQ139506 NF021A04PH1F1024 Phoma-infected Medicago truncatula cDNA clone
NF021A04PH 5', mRNA sequence
Length = 365
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 100 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 57
>gb|AJ502053.1|AJ502053 AJ502053 MTAMP Medicago truncatula cDNA clone mtgmadc120015b07,
mRNA sequence
Length = 472
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 135 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 92
>gb|CA919363.1|CA919363 EST637081 MTUS Medicago truncatula cDNA clone MTUS-12F5, mRNA
sequence
Length = 667
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Plus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 559 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 602
>gb|CA921752.1|CA921752 EST639470 MTUS Medicago truncatula cDNA clone MTUS-44A5, mRNA
sequence
Length = 594
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 62 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 19
>gb|CF068801.1|CF068801 EST669522 MTUS Medicago truncatula cDNA clone MTUS-12F5, mRNA
sequence
Length = 588
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 92 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 49
>gb|AJ846513.1|AJ846513 AJ846513 MtSCF Medicago truncatula cDNA clone MtCF05K21S6, mRNA
sequence
Length = 418
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 129 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 86
>gb|AJ847287.1|AJ847287 AJ847287 MtSTW Medicago truncatula cDNA clone MtTW07M24N2, mRNA
sequence
Length = 437
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 83 gtggcccatgcaagacctccgacgaagcaacggtattcaacatc 40
>gb|CX524027.1|CX524027 s13dNF12G08AT056_447398 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 490
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 117 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 74
>gb|CX525585.1|CX525585 s13dNF24G05AT040_479804 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 522
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 117 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 74
>gb|CX525951.1|CX525951 s13dNF32F09AT079_509646 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 627
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 96 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 53
>gb|CX526843.1|CX526843 s13dNF27C03AT022_514198 Aphid-Infected Shoots Medicago truncatula
cDNA, mRNA sequence
Length = 620
Score = 40.1 bits (20), Expect = 0.33
Identities = 38/44 (86%)
Strand = Plus / Minus
Query: 785 gtggcccaggcgaggccgccgacgaagcagcggtactcaacatc 828
|||||||| || || || ||||||||||| ||||| ||||||||
Sbjct: 107 gtggcccatgcaagacctccgacgaagcaccggtattcaacatc 64
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 103,893
Number of Sequences: 392609
Number of extensions: 103893
Number of successful extensions: 6272
Number of sequences better than 0.5: 56
Number of HSP's better than 0.5 without gapping: 56
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 6174
Number of HSP's gapped (non-prelim): 98
length of query: 943
length of database: 441,732,993
effective HSP length: 20
effective length of query: 923
effective length of database: 433,880,813
effective search space: 400471990399
effective search space used: 400471990399
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)