BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.593
(1027 letters)
Database: Mt_nucl_with_EST.fasta
392,609 sequences; 441,732,993 total letters
Score E
Sequences producing significant alignments: (bits) Value
emb|CR297089.1| mte1-14C3RM1 BAC end, cultivar Jemalong A17... 56 6e-006
gb|AW267781.1|AW267781 EST305909 DSIR Medicago truncatula c... 56 6e-006
gb|AW559461.1|AW559461 EST314509 DSIR Medicago truncatula c... 56 6e-006
gb|AW560047.1|AW560047 EST315095 DSIR Medicago truncatula c... 56 6e-006
gb|AW560048.1|AW560048 EST315096 DSIR Medicago truncatula c... 56 6e-006
gb|AW560177.1|AW560177 EST315225 DSIR Medicago truncatula c... 56 6e-006
gb|AW560867.1|AW560867 EST315915 DSIR Medicago truncatula c... 56 6e-006
gb|AW685138.1|AW685138 NF025D08NR1F1000 Nodulated root Medi... 56 6e-006
gb|BE997567.1|BE997567 EST429290 GVSN Medicago truncatula c... 56 6e-006
gb|BF632056.1|BF632056 NF040G09DT1F1069 Drought Medicago tr... 56 6e-006
gb|BF633283.1|BF633283 NF047D03DT1F1028 Drought Medicago tr... 56 6e-006
gb|BF636360.1|BF636360 NF089E04DT1F1034 Drought Medicago tr... 56 6e-006
gb|BF636395.1|BF636395 NF090A04DT1F1024 Drought Medicago tr... 56 6e-006
gb|BF637904.1|BF637904 NF029F08PL1F1073 Phosphate starved l... 56 6e-006
gb|BF638282.1|BF638282 NF053C09PL1F1068 Phosphate starved l... 56 6e-006
gb|BF646033.1|BF646033 NF043A03EC1F1020 Elicited cell cultu... 56 6e-006
gb|BF646362.1|BF646362 NF071A12EC1F1088 Elicited cell cultu... 56 6e-006
gb|BF650277.1|BF650277 NF087B10EC1F1079 Elicited cell cultu... 56 6e-006
gb|AW687771.2|AW687771 NF013C08RT1F1065 Developing root Med... 56 6e-006
gb|AW685242.2|AW685242 NF028A07NR1F1000 Nodulated root Medi... 56 6e-006
gb|BG447813.1|BG447813 NF103E05EC1F1037 Elicited cell cultu... 56 6e-006
gb|BG452415.1|BG452415 NF099G05LF1F1037 Developing leaf Med... 56 6e-006
gb|BG452980.1|BG452980 NF086F05LF1F1044 Developing leaf Med... 56 6e-006
gb|BQ165427.1|BQ165427 EST611296 KVKC Medicago truncatula c... 56 6e-006
gb|BQ165428.1|BQ165428 EST611297 KVKC Medicago truncatula c... 56 6e-006
gb|AJ501010.1|AJ501010 AJ501010 MTAMP Medicago truncatula c... 56 6e-006
gb|AJ501186.1|AJ501186 AJ501186 MTAMP Medicago truncatula c... 56 6e-006
gb|AJ501743.1|AJ501743 AJ501743 MTAMP Medicago truncatula c... 56 6e-006
gb|AJ502049.1|AJ502049 AJ502049 MTAMP Medicago truncatula c... 56 6e-006
gb|CB892183.1|CB892183 EST649152 KV3 Medicago truncatula cD... 56 6e-006
gb|CB893707.1|CB893707 EST646499 HOGA Medicago truncatula c... 56 6e-006
gb|CB893753.1|CB893753 EST646545 HOGA Medicago truncatula c... 56 6e-006
gb|CB895070.1|CB895070 EST647862 HOGA Medicago truncatula c... 56 6e-006
gb|AJ500330.1|AJ500330 AJ500330 MTGIM Medicago truncatula c... 56 6e-006
gb|DW015521.1|DW015521 EST1224482 MTY Medicago truncatula c... 56 6e-006
gb|AC121239.34| Medicago truncatula clone mth1-8p19, comple... 56 6e-006
emb|Y10373.1|MTCHITIN1 M.truncatula mRNA for chitinase 56 6e-006
emb|CT025534.4| M.truncatula DNA sequence from clone MTH2-1... 56 6e-006
gb|BQ153545.1|BQ153545 NF039H01IR1F1015 Irradiated Medicago... 52 9e-005
gb|AW684371.1|AW684371 NF016B09NR1F1000 Nodulated root Medi... 50 4e-004
gb|AJ548267.1|AJ548267 AJ548267 MTAPHEU Medicago truncatula... 48 0.001
gb|AL382691.1|AL382691 MtBC09D09F1 MtBC Medicago truncatula... 44 0.023
gb|BE942180.1|BE942180 EST421759 MGHG Medicago truncatula c... 44 0.023
gb|BE943303.1|BE943303 EST422882 MGHG Medicago truncatula c... 44 0.023
gb|BE997667.1|BE997667 EST429390 GVSN Medicago truncatula c... 44 0.023
gb|BF632801.1|BF632801 NF051E02DT1F1008 Drought Medicago tr... 44 0.023
gb|BG455179.1|BG455179 NF068B09PL1F1075 Phosphate starved l... 44 0.023
gb|BQ152522.1|BQ152522 NF019F07IR1F1061 Irradiated Medicago... 44 0.023
gb|BQ155216.1|BQ155216 NF077E04IR1F1035 Irradiated Medicago... 44 0.023
gb|BQ157165.1|BQ157165 NF101F12IR1F1103 Irradiated Medicago... 44 0.023
gb|CX531641.1|CX531641 s13dNF80C04MJ022_257227 Methyl Jasmo... 44 0.023
gb|CA921973.1|CA921973 EST639691 MTUS Medicago truncatula c... 40 0.36
>emb|CR297089.1| mte1-14C3RM1 BAC end, cultivar Jemalong A17 of Medicago truncatula,
genomic survey sequence
Length = 328
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 113 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 54
>gb|AW267781.1|AW267781 EST305909 DSIR Medicago truncatula cDNA clone pDSIR-8C11, mRNA
sequence
Length = 699
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 410 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 469
>gb|AW559461.1|AW559461 EST314509 DSIR Medicago truncatula cDNA clone pDSIR-19M3, mRNA
sequence
Length = 604
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 395 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 454
>gb|AW560047.1|AW560047 EST315095 DSIR Medicago truncatula cDNA clone pDSIR-26G13, mRNA
sequence
Length = 629
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 322 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 381
Score = 42.1 bits (21), Expect = 0.091
Identities = 42/49 (85%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagcc 556
|||||||||| || | ||||||||||||||||| ||||| || |||||
Sbjct: 575 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagcc 623
>gb|AW560048.1|AW560048 EST315096 DSIR Medicago truncatula cDNA clone pDSIR-26G13, mRNA
sequence
Length = 738
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 399 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 458
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 652 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 709
>gb|AW560177.1|AW560177 EST315225 DSIR Medicago truncatula cDNA clone pDSIR-26G20, mRNA
sequence
Length = 661
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 398 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 457
>gb|AW560867.1|AW560867 EST315915 DSIR Medicago truncatula cDNA clone pDSIR-30O7, mRNA
sequence
Length = 598
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 404 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 463
>gb|AW685138.1|AW685138 NF025D08NR1F1000 Nodulated root Medicago truncatula cDNA clone
NF025D08NR 5', mRNA sequence
Length = 642
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 418 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 477
>gb|BE997567.1|BE997567 EST429290 GVSN Medicago truncatula cDNA clone pGVSN-1B17, mRNA
sequence
Length = 493
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 74 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 133
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 327 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 384
>gb|BF632056.1|BF632056 NF040G09DT1F1069 Drought Medicago truncatula cDNA clone NF040G09DT
5', mRNA sequence
Length = 551
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 419 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 478
>gb|BF633283.1|BF633283 NF047D03DT1F1028 Drought Medicago truncatula cDNA clone NF047D03DT
5', mRNA sequence
Length = 601
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 419 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 478
>gb|BF636360.1|BF636360 NF089E04DT1F1034 Drought Medicago truncatula cDNA clone NF089E04DT
5', mRNA sequence
Length = 609
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 425 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 484
>gb|BF636395.1|BF636395 NF090A04DT1F1024 Drought Medicago truncatula cDNA clone NF090A04DT
5', mRNA sequence
Length = 656
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 427 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 486
>gb|BF637904.1|BF637904 NF029F08PL1F1073 Phosphate starved leaf Medicago truncatula cDNA
clone NF029F08PL 5', mRNA sequence
Length = 642
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 244 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 303
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 497 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 554
>gb|BF638282.1|BF638282 NF053C09PL1F1068 Phosphate starved leaf Medicago truncatula cDNA
clone NF053C09PL 5', mRNA sequence
Length = 649
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 244 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 303
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 497 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 554
>gb|BF646033.1|BF646033 NF043A03EC1F1020 Elicited cell culture Medicago truncatula cDNA
clone NF043A03EC 5', mRNA sequence
Length = 647
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 421 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 480
>gb|BF646362.1|BF646362 NF071A12EC1F1088 Elicited cell culture Medicago truncatula cDNA
clone NF071A12EC 5', mRNA sequence
Length = 670
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 425 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 484
>gb|BF650277.1|BF650277 NF087B10EC1F1079 Elicited cell culture Medicago truncatula cDNA
clone NF087B10EC 5', mRNA sequence
Length = 610
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 247 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 306
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 500 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 557
>gb|AW687771.2|AW687771 NF013C08RT1F1065 Developing root Medicago truncatula cDNA clone
NF013C08RT 5', mRNA sequence
Length = 584
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 62 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 121
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 315 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 372
>gb|AW685242.2|AW685242 NF028A07NR1F1000 Nodulated root Medicago truncatula cDNA clone
NF028A07NR 5', mRNA sequence
Length = 645
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 412 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 471
>gb|BG447813.1|BG447813 NF103E05EC1F1037 Elicited cell culture Medicago truncatula cDNA
clone NF103E05EC 5', mRNA sequence
Length = 681
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 420 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 479
>gb|BG452415.1|BG452415 NF099G05LF1F1037 Developing leaf Medicago truncatula cDNA clone
NF099G05LF 5', mRNA sequence
Length = 688
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 414 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 473
>gb|BG452980.1|BG452980 NF086F05LF1F1044 Developing leaf Medicago truncatula cDNA clone
NF086F05LF 5', mRNA sequence
Length = 650
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 416 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 475
>gb|BQ165427.1|BQ165427 EST611296 KVKC Medicago truncatula cDNA clone pKVKC-9B4, mRNA
sequence
Length = 767
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 416 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 475
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 668 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 725
>gb|BQ165428.1|BQ165428 EST611297 KVKC Medicago truncatula cDNA clone pKVKC-9B4, mRNA
sequence
Length = 739
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 739 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 680
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 487 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 430
>gb|AJ501010.1|AJ501010 AJ501010 MTAMP Medicago truncatula cDNA clone mtgmadc120001f11,
mRNA sequence
Length = 671
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 458 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 517
>gb|AJ501186.1|AJ501186 AJ501186 MTAMP Medicago truncatula cDNA clone mtgmadc120003g09,
mRNA sequence
Length = 674
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 451 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 510
>gb|AJ501743.1|AJ501743 AJ501743 MTAMP Medicago truncatula cDNA clone mtgmadc120011c10,
mRNA sequence
Length = 577
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 437 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 496
>gb|AJ502049.1|AJ502049 AJ502049 MTAMP Medicago truncatula cDNA clone mtgmadc120015a03,
mRNA sequence
Length = 617
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 437 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 496
>gb|CB892183.1|CB892183 EST649152 KV3 Medicago truncatula cDNA clone KV3-53O18, mRNA
sequence
Length = 811
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 384 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 443
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 637 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 694
>gb|CB893707.1|CB893707 EST646499 HOGA Medicago truncatula cDNA clone HOGA-28D4, mRNA
sequence
Length = 810
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 316 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 375
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 569 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 626
>gb|CB893753.1|CB893753 EST646545 HOGA Medicago truncatula cDNA clone HOGA-28L14, mRNA
sequence
Length = 783
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 318 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 377
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 571 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 628
>gb|CB895070.1|CB895070 EST647862 HOGA Medicago truncatula cDNA clone HOGA-33B21, mRNA
sequence
Length = 532
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 74 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 133
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 327 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 384
>gb|AJ500330.1|AJ500330 AJ500330 MTGIM Medicago truncatula cDNA clone mtgmacc120015c02,
mRNA sequence
Length = 493
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 109 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 168
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 362 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 419
>gb|DW015521.1|DW015521 EST1224482 MTY Medicago truncatula cDNA clone MTYA631, mRNA
sequence
Length = 731
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 443 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 502
>gb|AC121239.34| Medicago truncatula clone mth1-8p19, complete sequence
Length = 100985
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 89666 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 89607
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 89413 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 89356
>emb|Y10373.1|MTCHITIN1 M.truncatula mRNA for chitinase
Length = 1315
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 427 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 486
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 680 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 737
>emb|CT025534.4| M.truncatula DNA sequence from clone MTH2-1H4 on chromosome 3, complete
sequence
Length = 100991
Score = 56.0 bits (28), Expect = 6e-006
Identities = 52/60 (86%)
Strand = Plus / Minus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 89663 cacgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 89604
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Minus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 89410 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 89353
>gb|BQ153545.1|BQ153545 NF039H01IR1F1015 Irradiated Medicago truncatula cDNA clone
NF039H01IR 5', mRNA sequence
Length = 352
Score = 52.0 bits (26), Expect = 9e-005
Identities = 50/58 (86%)
Strand = Plus / Plus
Query: 299 cgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 58 cgaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 115
>gb|AW684371.1|AW684371 NF016B09NR1F1000 Nodulated root Medicago truncatula cDNA clone
NF016B09NR 5', mRNA sequence
Length = 640
Score = 50.1 bits (25), Expect = 4e-004
Identities = 51/60 (85%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||| ||||||| ||||||||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 412 cacnaaaccacaggtggatgggcaactgcacctgatggcccatatgcttggggatactgc 471
>gb|AJ548267.1|AJ548267 AJ548267 MTAPHEU Medicago truncatula cDNA clone mtaehac110001b08,
mRNA sequence
Length = 269
Score = 48.1 bits (24), Expect = 0.001
Identities = 51/60 (85%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatggaccgtttgcctggggatactgc 356
||||||||||| |||| |||||| ||||| || ||||| || | ||| ||||||||||||
Sbjct: 112 cacgaaaccacaggtgaatgggcaactgcacctgatggcccatatgcttggggatactgc 171
>gb|AL382691.1|AL382691 MtBC09D09F1 MtBC Medicago truncatula cDNA clone MtBC09D09 T3, mRNA
sequence
Length = 482
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 106 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 163
>gb|BE942180.1|BE942180 EST421759 MGHG Medicago truncatula cDNA clone pMGHG-7B24, mRNA
sequence
Length = 400
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 9 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 66
>gb|BE943303.1|BE943303 EST422882 MGHG Medicago truncatula cDNA clone pMGHG-15I16, mRNA
sequence
Length = 583
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 97 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 154
>gb|BE997667.1|BE997667 EST429390 GVSN Medicago truncatula cDNA clone pGVSN-1F10, mRNA
sequence
Length = 471
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 80 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 137
>gb|BF632801.1|BF632801 NF051E02DT1F1008 Drought Medicago truncatula cDNA clone NF051E02DT
5', mRNA sequence
Length = 437
Score = 44.1 bits (22), Expect = 0.023
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatgg 334
||||||||||| ||||||||||| ||||| || |||||
Sbjct: 390 cacgaaaccacaggtggatgggcaactgcacctgatgg 427
>gb|BG455179.1|BG455179 NF068B09PL1F1075 Phosphate starved leaf Medicago truncatula cDNA
clone NF068B09PL 5', mRNA sequence
Length = 669
Score = 44.1 bits (22), Expect = 0.023
Identities = 34/38 (89%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcgactgctccggatgg 334
||||||||||| ||||||||||| ||||| || |||||
Sbjct: 423 cacgaaaccacaggtggatgggcaactgcacctgatgg 460
>gb|BQ152522.1|BQ152522 NF019F07IR1F1061 Irradiated Medicago truncatula cDNA clone
NF019F07IR 5', mRNA sequence
Length = 540
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 112 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 169
>gb|BQ155216.1|BQ155216 NF077E04IR1F1035 Irradiated Medicago truncatula cDNA clone
NF077E04IR 5', mRNA sequence
Length = 396
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 309 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 366
Score = 42.1 bits (21), Expect = 0.091
Identities = 52/61 (85%), Gaps = 1/61 (1%)
Strand = Plus / Plus
Query: 297 cacgaaaccaccggtggatgggcga-ctgctccggatggaccgtttgcctggggatactg 355
||||||||||| ||||||||||| | |||| || ||||| || | ||| |||||||||||
Sbjct: 55 cacgaaaccacaggtggatgggcaacctgcacctgatggcccatatgcttggggatactg 114
Query: 356 c 356
|
Sbjct: 115 c 115
>gb|BQ157165.1|BQ157165 NF101F12IR1F1103 Irradiated Medicago truncatula cDNA clone
NF101F12IR 5', mRNA sequence
Length = 616
Score = 44.1 bits (22), Expect = 0.023
Identities = 49/58 (84%)
Strand = Plus / Plus
Query: 508 ccttcaagacggccatctggttctggatgacgccgcagtcgcccaagccgtcgtgcca 565
|||||||||| || | ||||||||||||||||| ||||| || ||||| || |||||
Sbjct: 107 ccttcaagaccgctctatggttctggatgacgccccagtcacctaagccatcctgcca 164
Database: Mt_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:25 PM
Number of letters in database: 441,732,993
Number of sequences in database: 392,609
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 133,120
Number of Sequences: 392609
Number of extensions: 133120
Number of successful extensions: 8649
Number of sequences better than 0.5: 52
Number of HSP's better than 0.5 without gapping: 52
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 8554
Number of HSP's gapped (non-prelim): 95
length of query: 1027
length of database: 441,732,993
effective HSP length: 20
effective length of query: 1007
effective length of database: 433,880,813
effective search space: 436917978691
effective search space used: 436917978691
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)