BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 131537.2.148
         (977 letters)

Database: Mt_nucl_with_EST.fasta 
           392,609 sequences; 441,732,993 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AC125478.14|  Medicago truncatula clone mth2-31i19, compl...    44   0.022
gb|AC149638.28|  Medicago truncatula clone mth2-146j8, WORKI...    40   0.34 
gb|AC123573.39|  Medicago truncatula clone mth2-5n3, WORKING...    40   0.34 

>gb|AC125478.14| Medicago truncatula clone mth2-31i19, complete sequence
          Length = 111256

 Score = 44.1 bits (22), Expect = 0.022
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 75    ggacacacactactgaattgaaacta 100
             |||||||||||| |||||||||||||
Sbjct: 48351 ggacacacactattgaattgaaacta 48326



>gb|AC149638.28| Medicago truncatula clone mth2-146j8, WORKING DRAFT SEQUENCE, 2 ordered
             pieces
          Length = 130290

 Score = 40.1 bits (20), Expect = 0.34
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 115   ctagctagcttgtttcatcc 134
             ||||||||||||||||||||
Sbjct: 63341 ctagctagcttgtttcatcc 63360



>gb|AC123573.39| Medicago truncatula clone mth2-5n3, WORKING DRAFT SEQUENCE, 2 unordered
             pieces
          Length = 112326

 Score = 40.1 bits (20), Expect = 0.34
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 47    ttaattatttatttgcataa 66
             ||||||||||||||||||||
Sbjct: 15473 ttaattatttatttgcataa 15492



  Database: Mt_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:25 PM
  Number of letters in database: 441,732,993
  Number of sequences in database:  392,609
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 187,278
Number of Sequences: 392609
Number of extensions: 187278
Number of successful extensions: 14782
Number of sequences better than  0.5: 3
Number of HSP's better than  0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 14769
Number of HSP's gapped (non-prelim): 13
length of query: 977
length of database: 441,732,993
effective HSP length: 20
effective length of query: 957
effective length of database: 433,880,813
effective search space: 415223938041
effective search space used: 415223938041
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)