BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QBTB.068P22F020924.3.1
(714 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO513346.1|CO513346 s13dSG37H0900076_129856 Glandular tr... 64 1e-010
>gb|CO513346.1|CO513346 s13dSG37H0900076_129856 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 595
Score = 63.9 bits (32), Expect = 1e-010
Identities = 131/164 (79%)
Strand = Plus / Plus
Query: 539 tatgcgaggtggttggaagagcacaatcggcaaattagtgaactaagggctggtgtcagt 598
||||| |||||| |||||||||| ||||| ||||||| ||| || || || | ||| | |
Sbjct: 180 tatgcaaggtggctggaagagcagaatcgacaaattaatgagctgagagcagctgtaaat 239
Query: 599 gctcatgcaagtgatactgatcttcgaagtgttgttgataagatcatgtcacactatgat 658
|||||||||||||||| || ||||| | |||||||| | || |||| ||||||
Sbjct: 240 tctcatgcaagtgataccgaacttcgcatgattgttgatggtgtagtggcacattatgat 299
Query: 659 gagatttttaggctcaaaggcaatgcagccaaggcagatgtttt 702
|||||||||||||| ||||| |||||| ||||| ||||||||
Sbjct: 300 gagatttttaggctgaaaggtgttgcagctaaggctgatgtttt 343
Score = 40.1 bits (20), Expect = 0.002
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 425 acccaactagagcaagagct 444
||||||||||||||||||||
Sbjct: 66 acccaactagagcaagagct 85
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1703
Number of Sequences: 7669
Number of extensions: 1703
Number of successful extensions: 436
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 432
Number of HSP's gapped (non-prelim): 4
length of query: 714
length of database: 3,745,706
effective HSP length: 16
effective length of query: 698
effective length of database: 3,623,002
effective search space: 2528855396
effective search space used: 2528855396
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)