BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QBJ23f06.xg.2.1
         (683 letters)

Database: MedicagoSativa_nucl_with_EST.fasta 
           7669 sequences; 3,745,706 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

emb|Y11348.1|MSNANN  M.sativa mRNA for annexin-like protein        36   0.031

>emb|Y11348.1|MSNANN M.sativa mRNA for annexin-like protein
          Length = 1533

 Score = 36.2 bits (18), Expect = 0.031
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 553 gatgcaaaggatttgtacaaagctgg 578
           |||||||||| | |||||||||||||
Sbjct: 620 gatgcaaaggttctgtacaaagctgg 645



  Database: MedicagoSativa_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:23 PM
  Number of letters in database: 3,745,706
  Number of sequences in database:  7669
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 868
Number of Sequences: 7669
Number of extensions: 868
Number of successful extensions: 199
Number of sequences better than  0.5: 1
Number of HSP's better than  0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 197
Number of HSP's gapped (non-prelim): 2
length of query: 683
length of database: 3,745,706
effective HSP length: 16
effective length of query: 667
effective length of database: 3,623,002
effective search space: 2416542334
effective search space used: 2416542334
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)