BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QAS2h09.yg.3.5
(1992 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO512415.1|CO512415 s13dSG80F0600047_114344 Glandular tr... 54 4e-007
gb|CO512074.1|CO512074 s13dSG18E1000071_108468 Glandular tr... 34 0.36
gb|L37606.1|ALFNDGS Medicago sativa (clone GG16-1) NADH-dep... 34 0.36
gb|L01660.1|ALFNADHSYN Medicago sativa NADH-glutamate synth... 34 0.36
gb|CO512644.1|CO512644 s13dSG13G1100084_121214 Glandular tr... 32 1.4
gb|CO513208.1|CO513208 s13dSG24B1200093_129580 Glandular tr... 32 1.4
gb|CO513965.1|CO513965 s13dSG71G0100004_156592 Glandular tr... 32 1.4
gb|CO514700.1|CO514700 s13dSG55A0800065_328060 Glandular tr... 32 1.4
gb|U20736.1|MSU20736 Medicago sativa S-adenosyl-L-methionin... 32 1.4
gb|AF079404.1|AF079404 Medicago sativa subsp. X varia cell ... 32 1.4
emb|AX008931.1| Sequence 1 from Patent WO9964451 32 1.4
emb|AX259371.1| Sequence 1 from Patent WO0173090 32 1.4
dbj|BD210105.1| Plant protein having repeated WD40 motif, n... 32 1.4
emb|CQ760958.1| Sequence 3 from Patent WO2004002216 32 1.4
emb|CQ760964.1| Sequence 9 from Patent WO2004002216 32 1.4
gb|CB858135.1|CB858135 RX73 Medicago sativa cDNA-AFLP Medic... 30 5.7
gb|CO511949.1|CO511949 s13dSG05H0900080_103798 Glandular tr... 30 5.7
gb|CO512146.1|CO512146 s13dSG34D1200094_108612 Glandular tr... 30 5.7
gb|CO512192.1|CO512192 s13dSG03B0200013_113898 Glandular tr... 30 5.7
gb|CO512810.1|CO512810 s13dSG20A0400021_121546 Glandular tr... 30 5.7
gb|CO513234.1|CO513234 s13dSG24E0800055_129632 Glandular tr... 30 5.7
gb|CO513273.1|CO513273 s13dSG37A1000069_129710 Glandular tr... 30 5.7
gb|CO513313.1|CO513313 s13dSG37E1100083_129790 Glandular tr... 30 5.7
gb|CO513487.1|CO513487 s13dSG10H0800064_130138 Glandular tr... 30 5.7
gb|CO513493.1|CO513493 s13dSG12A0800053_139768 Glandular tr... 30 5.7
gb|CO513849.1|CO513849 s13dSG73C1200086_156360 Glandular tr... 30 5.7
gb|CO514066.1|CO514066 s13dSG72H0900076_156794 Glandular tr... 30 5.7
gb|CO514516.1|CO514516 s13dSG43F0700061_327692 Glandular tr... 30 5.7
gb|CO515524.1|CO515524 s13dSG52G0700056_418107 Glandular tr... 30 5.7
gb|CO515669.1|CO515669 s13dSG60D0600058_419487 Glandular tr... 30 5.7
gb|CO515965.1|CO515965 s13dSG61D0400032_445258 Glandular tr... 30 5.7
gb|CO516136.1|CO516136 s13dSG65G1000084_445600 Glandular tr... 30 5.7
gb|CO516159.1|CO516159 s13dSG67A1200097_445646 Glandular tr... 30 5.7
gb|CO516807.1|CO516807 s13dSG94H0400041_446942 Glandular tr... 30 5.7
gb|CO516884.1|CO516884 s13dSG58A1000071_468314 Glandular tr... 30 5.7
gb|CO517001.1|CO517001 s13dSG81G0900070_468548 Glandular tr... 30 5.7
gb|CO517133.1|CO517133 s13dSG29H0500048_468812 Glandular tr... 30 5.7
emb|X88864.1|MSCYCPROT M.sativa mRNA for cyclin protein 30 5.7
emb|AJ132929.1|MSA132929 Medicago sativa cycD3 gene, type I... 30 5.7
gb|AF355597.1|AF355597 Medicago sativa MscN4 putative nodul... 30 5.7
gb|AF355596.1| Medicago sativa nodule clone MsNc20a mRNA, c... 30 5.7
emb|AJ293275.1|MVA293275 Medicago sativa subsp. x varia mRN... 30 5.7
>gb|CO512415.1|CO512415 s13dSG80F0600047_114344 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 565
Score = 54.0 bits (27), Expect = 4e-007
Identities = 54/63 (85%)
Strand = Plus / Plus
Query: 398 aaggtgcggaaagagttgtaggctgaggtggataaactatctgaggccagacctcaagag 457
||||||||| ||||||||||| || || ||||| ||||||||||| | |||||||| ||
Sbjct: 304 aaggtgcgggaagagttgtagactaagatggattaactatctgagaactgacctcaaaag 363
Query: 458 agg 460
|||
Sbjct: 364 agg 366
>gb|CO512074.1|CO512074 s13dSG18E1000071_108468 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 550
Score = 34.2 bits (17), Expect = 0.36
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1783 tgaaaattgatgttttc 1799
|||||||||||||||||
Sbjct: 47 tgaaaattgatgttttc 31
>gb|L37606.1|ALFNDGS Medicago sativa (clone GG16-1) NADH-dependent glutamate synthase gene,
complete cds
Length = 14306
Score = 34.2 bits (17), Expect = 0.36
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1093 ttccacctgataatcct 1109
|||||||||||||||||
Sbjct: 10530 ttccacctgataatcct 10514
>gb|L01660.1|ALFNADHSYN Medicago sativa NADH-glutamate synthase mRNA, comlete cds
Length = 7174
Score = 34.2 bits (17), Expect = 0.36
Identities = 17/17 (100%)
Strand = Plus / Minus
Query: 1093 ttccacctgataatcct 1109
|||||||||||||||||
Sbjct: 4584 ttccacctgataatcct 4568
>gb|CO512644.1|CO512644 s13dSG13G1100084_121214 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 574
Score = 32.2 bits (16), Expect = 1.4
Identities = 19/20 (95%)
Strand = Plus / Minus
Query: 318 gaggatgagaaactcatgaa 337
||||||||||||| ||||||
Sbjct: 334 gaggatgagaaacacatgaa 315
>gb|CO513208.1|CO513208 s13dSG24B1200093_129580 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 598
Score = 32.2 bits (16), Expect = 1.4
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 1766 tctcctttcctttctc 1781
||||||||||||||||
Sbjct: 56 tctcctttcctttctc 71
>gb|CO513965.1|CO513965 s13dSG71G0100004_156592 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 566
Score = 32.2 bits (16), Expect = 1.4
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 603 ctgaggcagaaaggca 618
||||||||||||||||
Sbjct: 313 ctgaggcagaaaggca 328
>gb|CO514700.1|CO514700 s13dSG55A0800065_328060 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 514
Score = 32.2 bits (16), Expect = 1.4
Identities = 19/20 (95%)
Strand = Plus / Minus
Query: 318 gaggatgagaaactcatgaa 337
||||||||||||| ||||||
Sbjct: 283 gaggatgagaaacacatgaa 264
>gb|U20736.1|MSU20736 Medicago sativa S-adenosyl-L-methionine:trans-caffeoyl-CoA
3-O-methyltransferase (CCOMT) mRNA, complete cds
Length = 966
Score = 32.2 bits (16), Expect = 1.4
Identities = 22/24 (91%)
Strand = Plus / Plus
Query: 1245 attctggagaacagtgtcttccca 1268
||||| |||| |||||||||||||
Sbjct: 132 attctagagaccagtgtcttccca 155
>gb|AF079404.1|AF079404 Medicago sativa subsp. X varia cell cycle switch protein (ccs52)
mRNA, complete cds
Length = 1988
Score = 32.2 bits (16), Expect = 1.4
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 271 cttgctgctacaagca 286
||||||||||||||||
Sbjct: 778 cttgctgctacaagca 763
>emb|AX008931.1| Sequence 1 from Patent WO9964451
Length = 2006
Score = 32.2 bits (16), Expect = 1.4
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 271 cttgctgctacaagca 286
||||||||||||||||
Sbjct: 778 cttgctgctacaagca 763
>emb|AX259371.1| Sequence 1 from Patent WO0173090
Length = 744
Score = 32.2 bits (16), Expect = 1.4
Identities = 22/24 (91%)
Strand = Plus / Plus
Query: 1245 attctggagaacagtgtcttccca 1268
||||| |||| |||||||||||||
Sbjct: 97 attctagagaccagtgtcttccca 120
>dbj|BD210105.1| Plant protein having repeated WD40 motif, nucleic acid encoding the
protein and utilization of the same
Length = 2006
Score = 32.2 bits (16), Expect = 1.4
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 271 cttgctgctacaagca 286
||||||||||||||||
Sbjct: 778 cttgctgctacaagca 763
>emb|CQ760958.1| Sequence 3 from Patent WO2004002216
Length = 744
Score = 32.2 bits (16), Expect = 1.4
Identities = 22/24 (91%)
Strand = Plus / Plus
Query: 1245 attctggagaacagtgtcttccca 1268
||||| |||| |||||||||||||
Sbjct: 97 attctagagaccagtgtcttccca 120
>emb|CQ760964.1| Sequence 9 from Patent WO2004002216
Length = 1906
Score = 32.2 bits (16), Expect = 1.4
Identities = 22/24 (91%)
Strand = Plus / Plus
Query: 1245 attctggagaacagtgtcttccca 1268
||||| |||| |||||||||||||
Sbjct: 1072 attctagagaccagtgtcttccca 1095
>gb|CB858135.1|CB858135 RX73 Medicago sativa cDNA-AFLP Medicago sativa cDNA, mRNA sequence
Length = 443
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 1285 aagaaaaagatacaa 1299
|||||||||||||||
Sbjct: 398 aagaaaaagatacaa 384
>gb|CO511949.1|CO511949 s13dSG05H0900080_103798 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 615
Score = 30.2 bits (15), Expect = 5.7
Identities = 18/19 (94%)
Strand = Plus / Plus
Query: 1385 tgatgatgtgatcaaggca 1403
||||||||||||| |||||
Sbjct: 238 tgatgatgtgatccaggca 256
>gb|CO512146.1|CO512146 s13dSG34D1200094_108612 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 566
Score = 30.2 bits (15), Expect = 5.7
Identities = 18/19 (94%)
Strand = Plus / Plus
Query: 1385 tgatgatgtgatcaaggca 1403
||||||||||||| |||||
Sbjct: 277 tgatgatgtgatccaggca 295
>gb|CO512192.1|CO512192 s13dSG03B0200013_113898 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 558
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 1570 atcagaagaagcaga 1584
|||||||||||||||
Sbjct: 221 atcagaagaagcaga 207
>gb|CO512810.1|CO512810 s13dSG20A0400021_121546 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 562
Score = 30.2 bits (15), Expect = 5.7
Identities = 18/19 (94%)
Strand = Plus / Plus
Query: 1385 tgatgatgtgatcaaggca 1403
||||||||||||| |||||
Sbjct: 278 tgatgatgtgatccaggca 296
>gb|CO513234.1|CO513234 s13dSG24E0800055_129632 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 582
Score = 30.2 bits (15), Expect = 5.7
Identities = 18/19 (94%)
Strand = Plus / Plus
Query: 1385 tgatgatgtgatcaaggca 1403
||||||||||||| |||||
Sbjct: 278 tgatgatgtgatccaggca 296
>gb|CO513273.1|CO513273 s13dSG37A1000069_129710 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 565
Score = 30.2 bits (15), Expect = 5.7
Identities = 18/19 (94%)
Strand = Plus / Plus
Query: 1385 tgatgatgtgatcaaggca 1403
||||||||||||| |||||
Sbjct: 281 tgatgatgtgatccaggca 299
>gb|CO513313.1|CO513313 s13dSG37E1100083_129790 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 550
Score = 30.2 bits (15), Expect = 5.7
Identities = 18/19 (94%)
Strand = Plus / Plus
Query: 1385 tgatgatgtgatcaaggca 1403
||||||||||||| |||||
Sbjct: 281 tgatgatgtgatccaggca 299
>gb|CO513487.1|CO513487 s13dSG10H0800064_130138 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 525
Score = 30.2 bits (15), Expect = 5.7
Identities = 18/19 (94%)
Strand = Plus / Minus
Query: 1452 cagcagccacagcaacagc 1470
|||||| ||||||||||||
Sbjct: 295 cagcagacacagcaacagc 277
>gb|CO513493.1|CO513493 s13dSG12A0800053_139768 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 565
Score = 30.2 bits (15), Expect = 5.7
Identities = 18/19 (94%)
Strand = Plus / Plus
Query: 1385 tgatgatgtgatcaaggca 1403
||||||||||||| |||||
Sbjct: 281 tgatgatgtgatccaggca 299
>gb|CO513849.1|CO513849 s13dSG73C1200086_156360 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 369
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 1677 tcctcagttgaagag 1691
|||||||||||||||
Sbjct: 132 tcctcagttgaagag 146
>gb|CO514066.1|CO514066 s13dSG72H0900076_156794 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 405
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 315 gaggaggatgagaaa 329
|||||||||||||||
Sbjct: 344 gaggaggatgagaaa 358
>gb|CO514516.1|CO514516 s13dSG43F0700061_327692 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 592
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 315 gaggaggatgagaaa 329
|||||||||||||||
Sbjct: 296 gaggaggatgagaaa 310
>gb|CO515524.1|CO515524 s13dSG52G0700056_418107 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 149
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 280 acaagcagaagctga 294
|||||||||||||||
Sbjct: 117 acaagcagaagctga 131
>gb|CO515669.1|CO515669 s13dSG60D0600058_419487 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 524
Score = 30.2 bits (15), Expect = 5.7
Identities = 18/19 (94%)
Strand = Plus / Plus
Query: 1385 tgatgatgtgatcaaggca 1403
||||||||||||| |||||
Sbjct: 278 tgatgatgtgatccaggca 296
>gb|CO515965.1|CO515965 s13dSG61D0400032_445258 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 472
Score = 30.2 bits (15), Expect = 5.7
Identities = 18/19 (94%)
Strand = Plus / Plus
Query: 1385 tgatgatgtgatcaaggca 1403
||||||||||||| |||||
Sbjct: 281 tgatgatgtgatccaggca 299
>gb|CO516136.1|CO516136 s13dSG65G1000084_445600 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 517
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 986 tatgaattcactctg 1000
|||||||||||||||
Sbjct: 313 tatgaattcactctg 327
>gb|CO516159.1|CO516159 s13dSG67A1200097_445646 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 558
Score = 30.2 bits (15), Expect = 5.7
Identities = 18/19 (94%)
Strand = Plus / Plus
Query: 1385 tgatgatgtgatcaaggca 1403
||||||||||||| |||||
Sbjct: 278 tgatgatgtgatccaggca 296
>gb|CO516807.1|CO516807 s13dSG94H0400041_446942 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 494
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 986 tatgaattcactctg 1000
|||||||||||||||
Sbjct: 313 tatgaattcactctg 327
>gb|CO516884.1|CO516884 s13dSG58A1000071_468314 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 437
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 315 gaggaggatgagaaa 329
|||||||||||||||
Sbjct: 194 gaggaggatgagaaa 208
>gb|CO517001.1|CO517001 s13dSG81G0900070_468548 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 453
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 315 gaggaggatgagaaa 329
|||||||||||||||
Sbjct: 403 gaggaggatgagaaa 417
>gb|CO517133.1|CO517133 s13dSG29H0500048_468812 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 325
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 315 gaggaggatgagaaa 329
|||||||||||||||
Sbjct: 262 gaggaggatgagaaa 276
>emb|X88864.1|MSCYCPROT M.sativa mRNA for cyclin protein
Length = 1861
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 1857 taaataaatatagat 1871
|||||||||||||||
Sbjct: 1491 taaataaatatagat 1477
>emb|AJ132929.1|MSA132929 Medicago sativa cycD3 gene, type I promoter and exons 1-4
Length = 4553
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 1857 taaataaatatagat 1871
|||||||||||||||
Sbjct: 3821 taaataaatatagat 3807
>gb|AF355597.1|AF355597 Medicago sativa MscN4 putative nodule membrane protein mRNA, complete
cds
Length = 2367
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 110 ctttgcaatttccca 124
|||||||||||||||
Sbjct: 1353 ctttgcaatttccca 1339
>gb|AF355596.1| Medicago sativa nodule clone MsNc20a mRNA, complete sequence
Length = 1776
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Plus
Query: 110 ctttgcaatttccca 124
|||||||||||||||
Sbjct: 971 ctttgcaatttccca 985
>emb|AJ293275.1|MVA293275 Medicago sativa subsp. x varia mRNA for MAP kinase kinase (PRK
gene)
Length = 1471
Score = 30.2 bits (15), Expect = 5.7
Identities = 15/15 (100%)
Strand = Plus / Minus
Query: 926 tttccctttccaaca 940
|||||||||||||||
Sbjct: 242 tttccctttccaaca 228
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: May 2, 2006 2:40 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4878
Number of Sequences: 7669
Number of extensions: 4878
Number of successful extensions: 1325
Number of sequences better than 10.0: 42
Number of HSP's better than 10.0 without gapping: 42
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 1251
Number of HSP's gapped (non-prelim): 74
length of query: 1992
length of database: 3,745,706
effective HSP length: 17
effective length of query: 1975
effective length of database: 3,615,333
effective search space: 7140282675
effective search space used: 7140282675
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)