BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= QAN24c09.yg.2.1
         (425 letters)

Database: MedicagoSativa_nucl_with_EST.fasta 
           7669 sequences; 3,745,706 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CO516105.1|CO516105  s13dSG65C1200098_445538 Glandular tr...    76   2e-014
gb|AW698685.1|AW698685  R125 non-glandular-haired subtracted...    34   0.076
gb|AW698688.1|AW698688  R12 non-glandular-haired subtracted ...    34   0.076
gb|CO512149.1|CO512149  s13dSG34E0300019_108618 Glandular tr...    34   0.076
gb|DQ122795.1|  Medicago sativa clone M22 putative cellulose...    34   0.076
gb|AW698341.1|AW698341  G143 glandular-haired subtracted cDN...    32   0.30 
gb|AW698681.1|AW698681  R11 non-glandular-haired subtracted ...    32   0.30 
gb|AW698683.1|AW698683  R121 non-glandular-haired subtracted...    32   0.30 
gb|AW698901.1|AW698901  r97 non-glandular-haired subtracted ...    32   0.30 

>gb|CO516105.1|CO516105 s13dSG65C1200098_445538 Glandular trichomes Medicago sativa cDNA,
           mRNA sequence
          Length = 529

 Score = 75.8 bits (38), Expect = 2e-014
 Identities = 56/62 (90%)
 Strand = Plus / Plus

                                                                       
Query: 228 atggagtggtgttgggattgatgattggtggaggaatgagcagttctgggtcattggagg 287
           |||| |||||||||| || |||||||||||||||||||| ||||| ||||| ||||||||
Sbjct: 273 atggggtggtgttggaatagatgattggtggaggaatgaacagttttgggtgattggagg 332

             
Query: 288 tg 289
           ||
Sbjct: 333 tg 334



>gb|AW698685.1|AW698685 R125 non-glandular-haired subtracted cDNA library Medicago sativa
           cDNA, mRNA sequence
          Length = 393

 Score = 34.2 bits (17), Expect = 0.076
 Identities = 23/26 (88%)
 Strand = Plus / Plus

                                     
Query: 400 ctgtacctgnnngggcggccgctcga 425
           |||||||||   ||||||||||||||
Sbjct: 368 ctgtacctgcccgggcggccgctcga 393



>gb|AW698688.1|AW698688 R12 non-glandular-haired subtracted cDNA library Medicago sativa
           cDNA, mRNA sequence
          Length = 356

 Score = 34.2 bits (17), Expect = 0.076
 Identities = 23/26 (88%)
 Strand = Plus / Minus

                                     
Query: 399 gctgtacctgnnngggcggccgctcg 424
           ||||||||||   |||||||||||||
Sbjct: 26  gctgtacctgcccgggcggccgctcg 1



>gb|CO512149.1|CO512149 s13dSG34E0300019_108618 Glandular trichomes Medicago sativa cDNA,
           mRNA sequence
          Length = 581

 Score = 34.2 bits (17), Expect = 0.076
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                            
Query: 69  gttttgttgtttgagaa 85
           |||||||||||||||||
Sbjct: 227 gttttgttgtttgagaa 243



>gb|DQ122795.1| Medicago sativa clone M22 putative cellulose synthase catalytic
           subunit mRNA, partial cds
          Length = 512

 Score = 34.2 bits (17), Expect = 0.076
 Identities = 23/25 (92%)
 Strand = Plus / Plus

                                    
Query: 248 atgattggtggaggaatgagcagtt 272
           ||||||||||||| ||||| |||||
Sbjct: 150 atgattggtggagaaatgaacagtt 174



>gb|AW698341.1|AW698341 G143 glandular-haired subtracted cDNA library Medicago sativa cDNA,
           mRNA sequence
          Length = 264

 Score = 32.2 bits (16), Expect = 0.30
 Identities = 22/25 (88%)
 Strand = Plus / Plus

                                    
Query: 401 tgtacctgnnngggcggccgctcga 425
           ||||||||   ||||||||||||||
Sbjct: 240 tgtacctgcccgggcggccgctcga 264



>gb|AW698681.1|AW698681 R11 non-glandular-haired subtracted cDNA library Medicago sativa
           cDNA, mRNA sequence
          Length = 168

 Score = 32.2 bits (16), Expect = 0.30
 Identities = 22/25 (88%)
 Strand = Plus / Minus

                                    
Query: 401 tgtacctgnnngggcggccgctcga 425
           ||||||||   ||||||||||||||
Sbjct: 25  tgtacctgcccgggcggccgctcga 1



>gb|AW698683.1|AW698683 R121 non-glandular-haired subtracted cDNA library Medicago sativa
           cDNA, mRNA sequence
          Length = 527

 Score = 32.2 bits (16), Expect = 0.30
 Identities = 22/25 (88%)
 Strand = Plus / Minus

                                    
Query: 401 tgtacctgnnngggcggccgctcga 425
           ||||||||   ||||||||||||||
Sbjct: 25  tgtacctgcccgggcggccgctcga 1



>gb|AW698901.1|AW698901 r97 non-glandular-haired subtracted cDNA library Medicago sativa
           cDNA, mRNA sequence
          Length = 212

 Score = 32.2 bits (16), Expect = 0.30
 Identities = 22/25 (88%)
 Strand = Plus / Plus

                                    
Query: 401 tgtacctgnnngggcggccgctcga 425
           ||||||||   ||||||||||||||
Sbjct: 188 tgtacctgcccgggcggccgctcga 212



  Database: MedicagoSativa_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:23 PM
  Number of letters in database: 3,745,706
  Number of sequences in database:  7669
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1165
Number of Sequences: 7669
Number of extensions: 1165
Number of successful extensions: 360
Number of sequences better than  0.5: 9
Number of HSP's better than  0.5 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 351
Number of HSP's gapped (non-prelim): 9
length of query: 425
length of database: 3,745,706
effective HSP length: 15
effective length of query: 410
effective length of database: 3,630,671
effective search space: 1488575110
effective search space used: 1488575110
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)