BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 3067375.2.1
(1829 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO516275.1|CO516275 s13dSG69E0200007_445878 Glandular tr... 36 0.084
>gb|CO516275.1|CO516275 s13dSG69E0200007_445878 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 415
Score = 36.2 bits (18), Expect = 0.084
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 572 tctattaataacaaaatagatt 593
||||||||||||||||| ||||
Sbjct: 34 tctattaataacaaaatggatt 13
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4697
Number of Sequences: 7669
Number of extensions: 4697
Number of successful extensions: 1358
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 1357
Number of HSP's gapped (non-prelim): 1
length of query: 1829
length of database: 3,745,706
effective HSP length: 17
effective length of query: 1812
effective length of database: 3,615,333
effective search space: 6550983396
effective search space used: 6550983396
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)