BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 3067267.2.1
         (893 letters)

Database: MedicagoSativa_nucl_with_EST.fasta 
           7669 sequences; 3,745,706 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|CO517097.1|CO517097  s13dSG29D0500046_468740 Glandular tr...    34   0.16 
gb|AF332134.1|  Medicago sativa FtsH protease (FtsH) mRNA, c...    34   0.16 
>gb|CO517097.1|CO517097 s13dSG29D0500046_468740 Glandular trichomes Medicago sativa cDNA,
           mRNA sequence
          Length = 411

 Score = 34.2 bits (17), Expect = 0.16
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                            
Query: 509 tgttcttgtggagaaaa 525
           |||||||||||||||||
Sbjct: 94  tgttcttgtggagaaaa 78
>gb|AF332134.1| Medicago sativa FtsH protease (FtsH) mRNA, complete cds; chloroplast
            gene for chloroplast product
          Length = 2352

 Score = 34.2 bits (17), Expect = 0.16
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                             
Query: 223  ttgatgagattgatgct 239
            |||||||||||||||||
Sbjct: 1104 ttgatgagattgatgct 1120

 Score = 34.2 bits (17), Expect = 0.16
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                
Query: 51  ccacctggaacaggaaagaca 71
           ||||||||||| |||||||||
Sbjct: 932 ccacctggaactggaaagaca 952
  Database: MedicagoSativa_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:23 PM
  Number of letters in database: 3,745,706
  Number of sequences in database:  7669
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2283
Number of Sequences: 7669
Number of extensions: 2283
Number of successful extensions: 668
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 665
Number of HSP's gapped (non-prelim): 3
length of query: 893
length of database: 3,745,706
effective HSP length: 16
effective length of query: 877
effective length of database: 3,623,002
effective search space: 3177372754
effective search space used: 3177372754
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)