BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2950290.2.1
         (1442 letters)

Database: MedicagoSativa_nucl_with_EST.fasta 
           7669 sequences; 3,745,706 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|U17436.1|MSU17436  Medicago sativa isoflavone reductase (...    36   0.067
gb|CO515150.1|CO515150  s13dSG40H1000092_399165 Glandular tr...    34   0.26 

>gb|U17436.1|MSU17436 Medicago sativa isoflavone reductase (IFR) gene, complete cds
          Length = 2730

 Score = 36.2 bits (18), Expect = 0.067
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 1392 aatataataagaactgaa 1409
            ||||||||||||||||||
Sbjct: 2661 aatataataagaactgaa 2678



>gb|CO515150.1|CO515150 s13dSG40H1000092_399165 Glandular trichomes Medicago sativa cDNA,
           mRNA sequence
          Length = 344

 Score = 34.2 bits (17), Expect = 0.26
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                
Query: 192 gttgcttaccagggttgtgct 212
           |||||||||||||||| ||||
Sbjct: 57  gttgcttaccagggttttgct 77



  Database: MedicagoSativa_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:23 PM
  Number of letters in database: 3,745,706
  Number of sequences in database:  7669
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3617
Number of Sequences: 7669
Number of extensions: 3617
Number of successful extensions: 715
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 713
Number of HSP's gapped (non-prelim): 2
length of query: 1442
length of database: 3,745,706
effective HSP length: 16
effective length of query: 1426
effective length of database: 3,623,002
effective search space: 5166400852
effective search space used: 5166400852
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)