BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2943856.2.2
(661 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO513012.1|CO513012 s13dSG09E1200087_121950 Glandular tr... 36 0.030
gb|CO513947.1|CO513947 s13dSG71E0500035_156556 Glandular tr... 36 0.030
gb|CO515131.1|CO515131 s13dSG40F1100095_399127 Glandular tr... 36 0.030
gb|CO516477.1|CO516477 s13dSG28D0500043_446282 Glandular tr... 36 0.030
gb|CO512192.1|CO512192 s13dSG03B0200013_113898 Glandular tr... 32 0.47
gb|CO512447.1|CO512447 s13dSG100A090006_114408 Glandular tr... 32 0.47
gb|CO513447.1|CO513447 s13dSG10C0900066_130058 Glandular tr... 32 0.47
gb|CO514621.1|CO514621 s13dSG46A0500037_327902 Glandular tr... 32 0.47
gb|CO515356.1|CO515356 s13dSG49B0600057_417771 Glandular tr... 32 0.47
gb|CO515429.1|CO515429 s13dSG50E0500039_417917 Glandular tr... 32 0.47
gb|CO515794.1|CO515794 s13dSG54B0200013_421127 Glandular tr... 32 0.47
gb|CO516364.1|CO516364 s13dSG99F0800073_446056 Glandular tr... 32 0.47
gb|CO516946.1|CO516946 s13dSG58H0300028_468438 Glandular tr... 32 0.47
gb|DR159675.1|DR159675 EST27 Medicago sativa cDNA-AFLP Medi... 32 0.47
emb|AJ002486.1|MSAJ2486 Medicago sativa mRNA for protein ph... 32 0.47
>gb|CO513012.1|CO513012 s13dSG09E1200087_121950 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 537
Score = 36.2 bits (18), Expect = 0.030
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 376 tcgttcttcttcttcttc 393
||||||||||||||||||
Sbjct: 52 tcgttcttcttcttcttc 35
>gb|CO513947.1|CO513947 s13dSG71E0500035_156556 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 517
Score = 36.2 bits (18), Expect = 0.030
Identities = 18/18 (100%)
Strand = Plus / Plus
Query: 378 gttcttcttcttcttcgt 395
||||||||||||||||||
Sbjct: 50 gttcttcttcttcttcgt 67
>gb|CO515131.1|CO515131 s13dSG40F1100095_399127 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 346
Score = 36.2 bits (18), Expect = 0.030
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 376 tcgttcttcttcttcttc 393
||||||||||||||||||
Sbjct: 97 tcgttcttcttcttcttc 80
>gb|CO516477.1|CO516477 s13dSG28D0500043_446282 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 472
Score = 36.2 bits (18), Expect = 0.030
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 376 tcgttcttcttcttcttc 393
||||||||||||||||||
Sbjct: 40 tcgttcttcttcttcttc 23
>gb|CO512192.1|CO512192 s13dSG03B0200013_113898 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 558
Score = 32.2 bits (16), Expect = 0.47
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 378 gttcttcttcttcttc 393
||||||||||||||||
Sbjct: 323 gttcttcttcttcttc 308
>gb|CO512447.1|CO512447 s13dSG100A090006_114408 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 557
Score = 32.2 bits (16), Expect = 0.47
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 378 gttcttcttcttcttc 393
||||||||||||||||
Sbjct: 65 gttcttcttcttcttc 50
>gb|CO513447.1|CO513447 s13dSG10C0900066_130058 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 575
Score = 32.2 bits (16), Expect = 0.47
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 378 gttcttcttcttcttc 393
||||||||||||||||
Sbjct: 58 gttcttcttcttcttc 43
>gb|CO514621.1|CO514621 s13dSG46A0500037_327902 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 624
Score = 32.2 bits (16), Expect = 0.47
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 378 gttcttcttcttcttc 393
||||||||||||||||
Sbjct: 46 gttcttcttcttcttc 61
>gb|CO515356.1|CO515356 s13dSG49B0600057_417771 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 583
Score = 32.2 bits (16), Expect = 0.47
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 380 tcttcttcttcttcgt 395
||||||||||||||||
Sbjct: 105 tcttcttcttcttcgt 90
>gb|CO515429.1|CO515429 s13dSG50E0500039_417917 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 493
Score = 32.2 bits (16), Expect = 0.47
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 317 ctgaaattgaagggaa 332
||||||||||||||||
Sbjct: 131 ctgaaattgaagggaa 146
>gb|CO515794.1|CO515794 s13dSG54B0200013_421127 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 255
Score = 32.2 bits (16), Expect = 0.47
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 376 tcgttcttcttcttct 391
||||||||||||||||
Sbjct: 69 tcgttcttcttcttct 54
>gb|CO516364.1|CO516364 s13dSG99F0800073_446056 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 454
Score = 32.2 bits (16), Expect = 0.47
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 375 ttcgttcttcttcttc 390
||||||||||||||||
Sbjct: 50 ttcgttcttcttcttc 65
>gb|CO516946.1|CO516946 s13dSG58H0300028_468438 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 354
Score = 32.2 bits (16), Expect = 0.47
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 378 gttcttcttcttcttc 393
||||||||||||||||
Sbjct: 219 gttcttcttcttcttc 234
>gb|DR159675.1|DR159675 EST27 Medicago sativa cDNA-AFLP Medicago sativa cDNA clone S7 5',
mRNA sequence
Length = 278
Score = 32.2 bits (16), Expect = 0.47
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 227 tcacctctacgttttc 242
||||||||||||||||
Sbjct: 227 tcacctctacgttttc 242
>emb|AJ002486.1|MSAJ2486 Medicago sativa mRNA for protein phosphatase 1, gamma subunit
Length = 1554
Score = 32.2 bits (16), Expect = 0.47
Identities = 19/20 (95%)
Strand = Plus / Minus
Query: 379 ttcttcttcttcttcgtcaa 398
||||||||||||||| ||||
Sbjct: 213 ttcttcttcttcttcttcaa 194
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2187
Number of Sequences: 7669
Number of extensions: 2187
Number of successful extensions: 790
Number of sequences better than 0.5: 16
Number of HSP's better than 0.5 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 728
Number of HSP's gapped (non-prelim): 45
length of query: 661
length of database: 3,745,706
effective HSP length: 16
effective length of query: 645
effective length of database: 3,623,002
effective search space: 2336836290
effective search space used: 2336836290
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)