BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2521865.2.1
(638 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AY639647.1| Medicago sativa GMPase (GMP) mRNA, complete cds 127 1e-029
gb|CO515396.1|CO515396 s13dSG49G0800068_417851 Glandular tr... 36 0.029
>gb|AY639647.1| Medicago sativa GMPase (GMP) mRNA, complete cds
Length = 1181
Score = 127 bits (64), Expect = 1e-029
Identities = 232/288 (80%)
Strand = Plus / Plus
Query: 68 tgtctgattggtcctgatgtcgccattggacctgggtgtgttgtggaggacggcgtgagg 127
||||| ||||| ||||||||||| || || ||||| || |||| ||| || || |||
Sbjct: 894 tgtctcattggacctgatgtcgctatcggtcctggctgcattgtagagtctggtgttagg 953
Query: 128 ctttcccgctgcactgtcatgcgcggcgtgcgtatcaagaagcatgcttgcatctcaaac 187
||||| |||||||| || ||||| || || || |||||||| ||||||||||| || |
Sbjct: 954 ctttcgcgctgcacagtaatgcgaggagtccggatcaagaaacatgcttgcatttccagt 1013
Query: 188 agcattatcggctggcactcaactgttggtcaatgggcacggatagagaatatgactatc 247
|| ||||| || ||||| || ||||| || |||||||| || | |||||||||||||||
Sbjct: 1014 agtattattgggtggcattccactgtcgggcaatgggctcgagtggagaatatgactatc 1073
Query: 248 ctgggggaggatgttcatgtgtgtgatgaggtgtacagcaatggcggtgttgttctccca 307
|| || || ||||||||||| ||||||||| | ||||||||||| ||||| ||| | ||
Sbjct: 1074 cttggagaagatgttcatgtttgtgatgagatttacagcaatggtggtgtggttttgccc 1133
Query: 308 cataaagagatcaagtcaagcattctgaagcctgagatcgtcatgtga 355
|| || ||||| ||| ||| ||||||||||| ||||| |||||||||
Sbjct: 1134 cacaaggagattaagacaaatattctgaagccagagattgtcatgtga 1181
>gb|CO515396.1|CO515396 s13dSG49G0800068_417851 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 592
Score = 36.2 bits (18), Expect = 0.029
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 486 aaactattgacaatgtat 503
||||||||||||||||||
Sbjct: 501 aaactattgacaatgtat 484
Score = 36.2 bits (18), Expect = 0.029
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 563 aaactattgacaatgtat 580
||||||||||||||||||
Sbjct: 501 aaactattgacaatgtat 484
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1539
Number of Sequences: 7669
Number of extensions: 1539
Number of successful extensions: 349
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 345
Number of HSP's gapped (non-prelim): 3
length of query: 638
length of database: 3,745,706
effective HSP length: 16
effective length of query: 622
effective length of database: 3,623,002
effective search space: 2253507244
effective search space used: 2253507244
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)