BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2521502.2.2
(1862 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO515300.1|CO515300 s13dSG48C1200098_417659 Glandular tr... 50 6e-006
gb|CO515609.1|CO515609 s13dSG47E0500039_418277 Glandular tr... 40 0.006
gb|CO514893.1|CO514893 s13dSG56F0300031_328446 Glandular tr... 38 0.022
gb|CO515135.1|CO515135 s13dSG40G0500040_399135 Glandular tr... 38 0.022
gb|CO515503.1|CO515503 s13dSG52D0800074_418065 Glandular tr... 38 0.022
gb|CO511782.1|CO511782 s13dSG02A0400033_103464 Glandular tr... 36 0.086
gb|CO515641.1|CO515641 s13dSG60B0200025_419431 Glandular tr... 36 0.086
gb|CO515878.1|CO515878 s13dSG91B1200095_421295 Glandular tr... 36 0.086
>gb|CO515300.1|CO515300 s13dSG48C1200098_417659 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 588
Score = 50.1 bits (25), Expect = 6e-006
Identities = 70/85 (82%)
Strand = Plus / Minus
Query: 1091 ccttgtaagggtaatccttctcggtgtcgattccgccattgttgatgatgaactcaaacg 1150
|||||||||||||||||| || | ||| || || ||||| |||||||||||||||| |
Sbjct: 569 ccttgtaagggtaatcctcttcagagtcaatgccaccattactgatgatgaactcaaagg 510
Query: 1151 catagtccatcagacctccattgca 1175
| || ||||| || || ||||||||
Sbjct: 509 cgtaatccataagtccaccattgca 485
>gb|CO515609.1|CO515609 s13dSG47E0500039_418277 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 591
Score = 40.1 bits (20), Expect = 0.006
Identities = 83/104 (79%)
Strand = Plus / Minus
Query: 799 tcgccccagctgctgccccatgagttcttcacgatccagtagtccttgccgttctctgtc 858
||||||||||| | |||||||| || |||| ||||| || || || ||||| |||||
Sbjct: 338 tcgccccagctaccaccccatgaatttctcacaatccaataatctttcccgttttctgta 279
Query: 859 ccgtagccgacggccgtgacaccatggtccagcgctgttccaca 902
||||| || || || | ||||||||||| || |||||||||||
Sbjct: 278 ccgtatccaacagctgcaacaccatggtctagtgctgttccaca 235
Score = 36.2 bits (18), Expect = 0.086
Identities = 24/26 (92%)
Strand = Plus / Minus
Query: 972 aggctggtttgcaactgccttctgca 997
||||||||||||||| ||||| ||||
Sbjct: 165 aggctggtttgcaacagccttttgca 140
Score = 36.2 bits (18), Expect = 0.086
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 1091 ccttgtaagggtaatcct 1108
||||||||||||||||||
Sbjct: 46 ccttgtaagggtaatcct 29
>gb|CO514893.1|CO514893 s13dSG56F0300031_328446 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 620
Score = 38.2 bits (19), Expect = 0.022
Identities = 31/35 (88%)
Strand = Plus / Minus
Query: 511 tcatgggggcagcagctgtagtgatcgtcgcagca 545
||||| |||||||| ||||||||||| || |||||
Sbjct: 335 tcatgagggcagcaactgtagtgatcatcacagca 301
>gb|CO515135.1|CO515135 s13dSG40G0500040_399135 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 330
Score = 38.2 bits (19), Expect = 0.022
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 1705 caggaggagcagcagcagc 1723
|||||||||||||||||||
Sbjct: 316 caggaggagcagcagcagc 298
>gb|CO515503.1|CO515503 s13dSG52D0800074_418065 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 431
Score = 38.2 bits (19), Expect = 0.022
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 1705 caggaggagcagcagcagc 1723
|||||||||||||||||||
Sbjct: 264 caggaggagcagcagcagc 246
>gb|CO511782.1|CO511782 s13dSG02A0400033_103464 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 536
Score = 36.2 bits (18), Expect = 0.086
Identities = 24/26 (92%)
Strand = Plus / Minus
Query: 972 aggctggtttgcaactgccttctgca 997
||||||||||||||| ||||| ||||
Sbjct: 40 aggctggtttgcaacagccttttgca 15
>gb|CO515641.1|CO515641 s13dSG60B0200025_419431 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 522
Score = 36.2 bits (18), Expect = 0.086
Identities = 24/26 (92%)
Strand = Plus / Minus
Query: 511 tcatgggggcagcagctgtagtgatc 536
||||| |||||||| |||||||||||
Sbjct: 28 tcatgagggcagcaactgtagtgatc 3
>gb|CO515878.1|CO515878 s13dSG91B1200095_421295 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 561
Score = 36.2 bits (18), Expect = 0.086
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 1709 aggagcagcagcagcagc 1726
||||||||||||||||||
Sbjct: 320 aggagcagcagcagcagc 303
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3557
Number of Sequences: 7669
Number of extensions: 3557
Number of successful extensions: 1202
Number of sequences better than 0.5: 8
Number of HSP's better than 0.5 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 1185
Number of HSP's gapped (non-prelim): 14
length of query: 1862
length of database: 3,745,706
effective HSP length: 17
effective length of query: 1845
effective length of database: 3,615,333
effective search space: 6670289385
effective search space used: 6670289385
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)