BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2441114.2.2
(962 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO512234.1|CO512234 s13dSG03E1200087_113982 Glandular tr... 52 7e-007
>gb|CO512234.1|CO512234 s13dSG03E1200087_113982 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 588
Score = 52.0 bits (26), Expect = 7e-007
Identities = 41/46 (89%)
Strand = Plus / Minus
Query: 772 tcttcagctagtttgccaacatgtccatacatggaatagtacacga 817
||||| |||||||| | ||||||||||||||||| ||||||||||
Sbjct: 131 tcttctgctagtttctccacatgtccatacatggagtagtacacga 86
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1672
Number of Sequences: 7669
Number of extensions: 1672
Number of successful extensions: 349
Number of sequences better than 0.5: 1
Number of HSP's better than 0.5 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 346
Number of HSP's gapped (non-prelim): 3
length of query: 962
length of database: 3,745,706
effective HSP length: 16
effective length of query: 946
effective length of database: 3,623,002
effective search space: 3427359892
effective search space used: 3427359892
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)