BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2440568.2.1
(1135 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|U35073.1|MSU35073 Medicago sativa nodulin (ENOD8) gene, ... 34 0.21
gb|L18899.1|ALFNOD8 Medicago sativa early nodule-specific p... 34 0.21
gb|DQ122837.1| Medicago sativa clone QH12 chloroplast thyla... 34 0.21
>gb|U35073.1|MSU35073 Medicago sativa nodulin (ENOD8) gene, complete cds
Length = 4716
Score = 34.2 bits (17), Expect = 0.21
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 351 gcaaacttcgcaacagc 367
|||||||||||||||||
Sbjct: 2847 gcaaacttcgcaacagc 2863
>gb|L18899.1|ALFNOD8 Medicago sativa early nodule-specific protein (ENOD8) gene,
complete cds
Length = 1303
Score = 34.2 bits (17), Expect = 0.21
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 351 gcaaacttcgcaacagc 367
|||||||||||||||||
Sbjct: 334 gcaaacttcgcaacagc 350
>gb|DQ122837.1| Medicago sativa clone QH12 chloroplast thylakoidal processing
peptidase mRNA, partial cds; nuclear gene for
chloroplast product
Length = 510
Score = 34.2 bits (17), Expect = 0.21
Identities = 23/25 (92%)
Strand = Plus / Minus
Query: 874 ccattgtagcgaactcataagcaag 898
|||||| ||| ||||||||||||||
Sbjct: 269 ccattggagccaactcataagcaag 245
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1978
Number of Sequences: 7669
Number of extensions: 1978
Number of successful extensions: 535
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 531
Number of HSP's gapped (non-prelim): 4
length of query: 1135
length of database: 3,745,706
effective HSP length: 16
effective length of query: 1119
effective length of database: 3,623,002
effective search space: 4054139238
effective search space used: 4054139238
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)