BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2419471.2.3
(1052 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AY560003.1| Medicago sativa S-adenosylmethionine synthas... 92 9e-019
gb|AW698879.1|AW698879 r109 non-glandular-haired subtracted... 64 2e-010
gb|CO514483.1|CO514483 s13dSG43C0600040_327626 Glandular tr... 36 0.048
>gb|AY560003.1| Medicago sativa S-adenosylmethionine synthase mRNA, complete cds
Length = 1173
Score = 91.7 bits (46), Expect = 9e-019
Identities = 271/346 (78%)
Strand = Plus / Minus
Query: 707 ccccagccaccgtaggtgtcgatgatgatcttccggccagtgaggccggcgtcgccgtga 766
||||| ||||| || ||||| ||||||||||||| |||||||| || || || ||||||
Sbjct: 788 ccccaaccaccataagtgtcaatgatgatcttcctaccagtgagaccagcatcaccgtga 729
Query: 767 ggtccgccgatgacgaagcggccagacgggttgaggtggaagattgtcttctcgtcgagg 826
|| || || |||||||| |||||||| ||||| | ||| || || ||||| || |||
Sbjct: 728 ggacctccaatgacgaaacggccagaagggttcaagtgaaaaatggtcttggaatcaagg 669
Query: 827 tactgctcggggatgactggcttgatgacgtgctccttcaggtcagcagcaatctcgtcg 886
|||| ||| || || || ||||| || || ||||| || || ||||||||||| || ||
Sbjct: 668 tacttctcaggaatcacaggctttataacatgctctttgagatcagcagcaatttcatca 609
Query: 887 ttggtgactgtctcgtcgtgctgggtagagatgaggactgtgtgcacacggatgggaacc 946
||||| || ||||| || || || ||||||||||| || ||||| ||||| | || |||
Sbjct: 608 ttggtaacagtctcatcatgttgagtagagatgagcacagtgtggacacgaacagggacc 549
Query: 947 atggcgccaccctcgttgcggtactccactgtcacctgggtcttcccatcgggcctgagc 1006
||||| ||| || ||| ||||| || || || || ||||| ||||| || || | |
Sbjct: 548 atggcaccattgtcattgtaatactcaacagtgacttgagtcttaccatcaggtctcaac 489
Query: 1007 caggggcaggttccattcttgcgaacctccgtgagaagagcaccaa 1052
|| ||||| || ||||||||||||||||| |||||| |||||||||
Sbjct: 488 caagggcatgtaccattcttgcgaacctcagtgagacgagcaccaa 443
Score = 36.2 bits (18), Expect = 0.048
Identities = 24/26 (92%)
Strand = Plus / Minus
Query: 341 ggcttcaccacctcccaggtgaagtc 366
||||||||||| ||||| ||||||||
Sbjct: 1154 ggcttcaccacttcccatgtgaagtc 1129
>gb|AW698879.1|AW698879 r109 non-glandular-haired subtracted cDNA library Medicago sativa
cDNA, mRNA sequence
Length = 205
Score = 63.9 bits (32), Expect = 2e-010
Identities = 59/68 (86%)
Strand = Plus / Minus
Query: 680 ccggagaaggcgcccccgccgtgggctccccagccaccgtaggtgtcgatgatgatcttc 739
|||||||| || || || ||||| || ||||| ||||||||||| ||||||||||||||
Sbjct: 70 ccggagaaagcaccaccaccgtgtgcaccccaaccaccgtaggtatcgatgatgatcttg 11
Query: 740 cggccagt 747
||||||||
Sbjct: 10 cggccagt 3
>gb|CO514483.1|CO514483 s13dSG43C0600040_327626 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 505
Score = 36.2 bits (18), Expect = 0.048
Identities = 63/78 (80%)
Strand = Plus / Minus
Query: 437 tcgaggttgatgatgatcatgccgggcctgaagtcgaagttctccttcacgatcttcagg 496
||||||||||| |||||| || ||||||||||| ||| || ||||| || || |||
Sbjct: 265 tcgaggttgatagagatcattccaggcctgaagtcaaaggattctttcacaatgttaagg 206
Query: 497 atctccttgtcggggatc 514
|| |||||||| ||||||
Sbjct: 205 atttccttgtcagggatc 188
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1790
Number of Sequences: 7669
Number of extensions: 1790
Number of successful extensions: 724
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 716
Number of HSP's gapped (non-prelim): 7
length of query: 1052
length of database: 3,745,706
effective HSP length: 16
effective length of query: 1036
effective length of database: 3,623,002
effective search space: 3753430072
effective search space used: 3753430072
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)