BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 2419471.2.1
(556 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO514747.1|CO514747 s13dSG55F1100095_328154 Glandular tr... 165 4e-041
gb|AY560003.1| Medicago sativa S-adenosylmethionine synthas... 163 2e-040
gb|CO514605.1|CO514605 s13dSG42G0700056_327870 Glandular tr... 155 4e-038
gb|CO516632.1|CO516632 s13dSG66E0200007_446592 Glandular tr... 143 2e-034
gb|CO515151.1|CO515151 s13dSG40H1100096_399167 Glandular tr... 32 0.39
>gb|CO514747.1|CO514747 s13dSG55F1100095_328154 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 435
Score = 165 bits (83), Expect = 4e-041
Identities = 235/283 (83%), Gaps = 2/283 (0%)
Strand = Plus / Plus
Query: 226 gtgaacgagggacaccctgacaagctctgcgaccaggtctcagatgctgttctggacgct 285
||||||||||| ||||| |||||||| ||||||||| |||| ||||| || || ||||||
Sbjct: 154 gtgaacgagggtcaccccgacaagctgtgcgaccagatctctgatgcagtgctcgacgct 213
Query: 286 tgccttgctgaggaccctgacagcaaggttgcttgcgagacctgcaccaagaccaacatg 345
|| |||| |||||||||||||||||| ||| || ||||| ||||||||||| ||||||
Sbjct: 214 tgtcttgagcaggaccctgacagcaagggtgcctgtgagacatgcaccaagactaacatg 273
Query: 346 gtcatggtctttggtgagatcaccaccaaggccaatgtcgactacgagaagattgtcagg 405
|||||||||||||| || || || ||||||||||| || ||||| |||||||| || |
Sbjct: 274 gtcatggtctttggagaaataacaaccaaggccaacgtagactatgagaagatcgttcgt 333
Query: 406 gagacatgccgcaacattggtttcgtgtcgaacgatgtcgggcttgacgctgaccactgc 465
|| |||||||||| |||||| ||| | || | ||||| || ||||| || ||| | |||
Sbjct: 334 gacacatgccgcaccattggattcatctctgatgatgttggtcttgatgccgacaaatgc 393
Query: 466 aaggtgcttgg-gaacattgagcagcagtcccctgatattgct 507
||||| ||||| ||||||||||||||| ||||||||||||
Sbjct: 394 aaggt-cttggtcaacattgagcagcagagtcctgatattgct 435
>gb|AY560003.1| Medicago sativa S-adenosylmethionine synthase mRNA, complete cds
Length = 1173
Score = 163 bits (82), Expect = 2e-040
Identities = 256/314 (81%)
Strand = Plus / Plus
Query: 202 accttcctcttcacctcggagtccgtgaacgagggacaccctgacaagctctgcgaccag 261
||||| || |||||||| ||||||||||| ||||| || || |||||||| || || ||
Sbjct: 7 acctttctattcacctctgagtccgtgaatgagggtcatcccgacaagctttgtgatcaa 66
Query: 262 gtctcagatgctgttctggacgcttgccttgctgaggaccctgacagcaaggttgcttgc 321
|||| |||||||| || || |||||||||| ||||| |||||||||||||| ||
Sbjct: 67 atctctgatgctgtgctagatgcttgccttgaacaggacgtagacagcaaggttgcatgt 126
Query: 322 gagacctgcaccaagaccaacatggtcatggtctttggtgagatcaccaccaaggccaat 381
||||| ||||| |||||||||||||| |||||||||||||||||||| |||||||| ||
Sbjct: 127 gagacttgcactaagaccaacatggttatggtctttggtgagatcacaaccaaggctaag 186
Query: 382 gtcgactacgagaagattgtcagggagacatgccgcaacattggtttcgtgtcgaacgat 441
|| ||||| ||||| ||||| | || || || | || ||||| || || || | |||
Sbjct: 187 gttgactatgagaaaattgtgcgtgatacctgtagaaagattgggtttgtttctgatgat 246
Query: 442 gtcgggcttgacgctgaccactgcaaggtgcttgggaacattgagcagcagtcccctgat 501
|| || ||||| |||||| |||||||||| |||| ||||||||||||||| ||||||
Sbjct: 247 gtaggtcttgatgctgacaactgcaaggttcttgtcaacattgagcagcagagtcctgat 306
Query: 502 attgctcagggtgt 515
||||||||||||||
Sbjct: 307 attgctcagggtgt 320
>gb|CO514605.1|CO514605 s13dSG42G0700056_327870 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 600
Score = 155 bits (78), Expect = 4e-038
Identities = 237/290 (81%)
Strand = Plus / Plus
Query: 226 gtgaacgagggacaccctgacaagctctgcgaccaggtctcagatgctgttctggacgct 285
||||||||||||||||| |||||||| ||||||||| |||| ||||| ||||| || |||
Sbjct: 149 gtgaacgagggacaccccgacaagctttgcgaccagatctctgatgccgttcttgatgct 208
Query: 286 tgccttgctgaggaccctgacagcaaggttgcttgcgagacctgcaccaagaccaacatg 345
||||| | | || || |||||||| ||||| || || || ||||| ||||||||||||
Sbjct: 209 tgcctcgagcaagatccagacagcaaagttgcatgtgaaacttgcacaaagaccaacatg 268
Query: 346 gtcatggtctttggtgagatcaccaccaaggccaatgtcgactacgagaagattgtcagg 405
|| |||||||||||||||||||| || || || ||||| ||||| || ||||||||| |
Sbjct: 269 gttatggtctttggtgagatcacaacaaaagcaaatgttgactatgaaaagattgtccgt 328
Query: 406 gagacatgccgcaacattggtttcgtgtcgaacgatgtcgggcttgacgctgaccactgc 465
| |||||| | ||||| ||||| || || ||||||| || ||||| |||||| |||||
Sbjct: 329 aacacatgcaggaacataggttttgtttcagacgatgttggtcttgatgctgacaactgc 388
Query: 466 aaggtgcttgggaacattgagcagcagtcccctgatattgctcagggtgt 515
|| || |||| |||||||| || ||| |||||||||||||| |||||
Sbjct: 389 aaagtccttgtcaacattgaacaacagagtcctgatattgctcaaggtgt 438
>gb|CO516632.1|CO516632 s13dSG66E0200007_446592 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 425
Score = 143 bits (72), Expect = 2e-034
Identities = 213/260 (81%)
Strand = Plus / Plus
Query: 226 gtgaacgagggacaccctgacaagctctgcgaccaggtctcagatgctgttctggacgct 285
||||||||||||||||| |||||||| ||||||||| |||| ||||| ||||| || |||
Sbjct: 149 gtgaacgagggacaccccgacaagctttgcgaccagatctctgatgccgttcttgatgct 208
Query: 286 tgccttgctgaggaccctgacagcaaggttgcttgcgagacctgcaccaagaccaacatg 345
||||| | | || || |||||||| ||||| || || || ||||| ||||||||||||
Sbjct: 209 tgcctcgagcaagatccagacagcaaagttgcatgtgaaacttgcacaaagaccaacatg 268
Query: 346 gtcatggtctttggtgagatcaccaccaaggccaatgtcgactacgagaagattgtcagg 405
|| |||||||||||||||||||| || || || ||||| ||||| || ||||||||| |
Sbjct: 269 gttatggtctttggtgagatcacaacaaaagcaaatgttgactatgaaaagattgtccgt 328
Query: 406 gagacatgccgcaacattggtttcgtgtcgaacgatgtcgggcttgacgctgaccactgc 465
| |||||| | ||||| ||||| || || ||||||| || ||||| |||||| |||||
Sbjct: 329 aacacatgcaggaacataggttttgtttcagacgatgttggtcttgatgctgacaactgc 388
Query: 466 aaggtgcttgggaacattga 485
|| || |||| ||||||||
Sbjct: 389 aaagtccttgtcaacattga 408
>gb|CO515151.1|CO515151 s13dSG40H1100096_399167 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 341
Score = 32.2 bits (16), Expect = 0.39
Identities = 16/16 (100%)
Strand = Plus / Minus
Query: 163 cgcagcagcagcagat 178
||||||||||||||||
Sbjct: 71 cgcagcagcagcagat 56
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 945
Number of Sequences: 7669
Number of extensions: 945
Number of successful extensions: 327
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 312
Number of HSP's gapped (non-prelim): 11
length of query: 556
length of database: 3,745,706
effective HSP length: 16
effective length of query: 540
effective length of database: 3,623,002
effective search space: 1956421080
effective search space used: 1956421080
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)