BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2405087.2.1
         (737 letters)

Database: MedicagoSativa_nucl_with_EST.fasta 
           7669 sequences; 3,745,706 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AF322116.2|AF322116  Medicago sativa sucrose-phosphate sy...    34   0.13 
gb|AY468362.2|  Medicago sativa sucrose-phosphate synthase g...    34   0.13 
>gb|AF322116.2|AF322116 Medicago sativa sucrose-phosphate synthase mRNA, complete cds
          Length = 3579

 Score = 34.2 bits (17), Expect = 0.13
 Identities = 47/57 (82%)
 Strand = Plus / Plus

                                                                     
Query: 322  tcccactgattttgatgctttcatctgcaatagtgggagtaacatttactatccttc 378
            ||||| ||||||||||||||  || ||||| ||||| ||| |  | |||||||||||
Sbjct: 2641 tcccaatgattttgatgcttatatttgcaacagtggcagtgatctctactatccttc 2697
>gb|AY468362.2| Medicago sativa sucrose-phosphate synthase gene, promoter region and
            complete cds
          Length = 8933

 Score = 34.2 bits (17), Expect = 0.13
 Identities = 47/57 (82%)
 Strand = Plus / Plus

                                                                     
Query: 322  tcccactgattttgatgctttcatctgcaatagtgggagtaacatttactatccttc 378
            ||||| ||||||||||||||  || ||||| ||||| ||| |  | |||||||||||
Sbjct: 7604 tcccaatgattttgatgcttatatttgcaacagtggcagtgatctctactatccttc 7660
  Database: MedicagoSativa_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:23 PM
  Number of letters in database: 3,745,706
  Number of sequences in database:  7669
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2161
Number of Sequences: 7669
Number of extensions: 2161
Number of successful extensions: 674
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 672
Number of HSP's gapped (non-prelim): 2
length of query: 737
length of database: 3,745,706
effective HSP length: 16
effective length of query: 721
effective length of database: 3,623,002
effective search space: 2612184442
effective search space used: 2612184442
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)