BLASTN 2.2.10 [Oct-19-2004]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 2404863.2.1
         (672 letters)

Database: MedicagoSativa_nucl_with_EST.fasta 
           7669 sequences; 3,745,706 total letters



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

gb|AY639647.1|  Medicago sativa GMPase (GMP) mRNA, complete cds    86   4e-017
gb|CO514062.1|CO514062  s13dSG72H0500044_156786 Glandular tr...    34   0.12 

>gb|AY639647.1| Medicago sativa GMPase (GMP) mRNA, complete cds
          Length = 1181

 Score = 85.7 bits (43), Expect = 4e-017
 Identities = 184/231 (79%)
 Strand = Plus / Plus

                                                                        
Query: 31   aggctttcccgctgcactgtcatgcgtggtgtgcgtatcaagaagcatgcctgcatctcg 90
            |||||||| |||||||| || ||||| || || || |||||||| ||||| ||||| || 
Sbjct: 951  aggctttcgcgctgcacagtaatgcgaggagtccggatcaagaaacatgcttgcatttcc 1010

                                                                        
Query: 91   aacagcattatcgggtggcactcaactgttggacaatgggcacggatagagaatatgacc 150
            |  || ||||| |||||||| || ||||| || |||||||| ||  | ||||||||||| 
Sbjct: 1011 agtagtattattgggtggcattccactgtcgggcaatgggctcgagtggagaatatgact 1070

                                                                        
Query: 151  atcctgggcgaggatgttcatgggggtgacgaggtatacagcaatggcggtgttgttctc 210
            ||||| || || ||||||||||   |||| ||| | ||||||||||| ||||| ||| | 
Sbjct: 1071 atccttggagaagatgttcatgtttgtgatgagatttacagcaatggtggtgtggttttg 1130

                                                               
Query: 211  ccacagaaagagatcaagtcaagcattttgaagcctgagatcgtcatgtga 261
            || || || ||||| ||| |||  ||| ||||||| ||||| |||||||||
Sbjct: 1131 ccccacaaggagattaagacaaatattctgaagccagagattgtcatgtga 1181



>gb|CO514062.1|CO514062 s13dSG72H0500044_156786 Glandular trichomes Medicago sativa cDNA,
           mRNA sequence
          Length = 522

 Score = 34.2 bits (17), Expect = 0.12
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                
Query: 542 tttatttttaaatgttgtcca 562
           |||||||| ||||||||||||
Sbjct: 479 tttattttgaaatgttgtcca 459



  Database: MedicagoSativa_nucl_with_EST.fasta
    Posted date:  Feb 7, 2006  2:23 PM
  Number of letters in database: 3,745,706
  Number of sequences in database:  7669
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1465
Number of Sequences: 7669
Number of extensions: 1465
Number of successful extensions: 458
Number of sequences better than  0.5: 2
Number of HSP's better than  0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 456
Number of HSP's gapped (non-prelim): 2
length of query: 672
length of database: 3,745,706
effective HSP length: 16
effective length of query: 656
effective length of database: 3,623,002
effective search space: 2376689312
effective search space used: 2376689312
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)