BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131584.2.3
(687 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AJ410120.1|AJ410120 AJ410120 Medicago sativa library (Ka... 133 2e-031
gb|CO512972.1|CO512972 s13dSG09A0800053_121870 Glandular tr... 32 0.49
>gb|AJ410120.1|AJ410120 AJ410120 Medicago sativa library (Kalo P) Medicago sativa cDNA
clone U40, mRNA sequence
Length = 757
Score = 133 bits (67), Expect = 2e-031
Identities = 209/255 (81%), Gaps = 1/255 (0%)
Strand = Plus / Minus
Query: 335 aggaacatcttgctgatgaatct-atccttgttcacaggcagagccttctttttgccctt 393
|||||||| ||||||||||| | ||||||||| || ||| |||||||||| || || ||
Sbjct: 395 aggaacattttgctgatgaaacggatccttgttgactggctgagccttcttctttccttt 336
Query: 394 gccagtcttggggacctctgtccacatctcccgcacgttctcgagcaccatgttacagtg 453
|||||||| || ||||| |||||||| ||||| || || || || ||||| || |||||
Sbjct: 335 accagtcttaggcacctcagtccacatttcccggacattttcaagaaccatattgcagtg 276
Query: 454 gcgatcaaaagcacgaacccggccaagcagcttcttgttgttgcggcaattgatgagaac 513
| ||||||||| | || ||||| || ||||| |||||||| || |||||||| |||||
Sbjct: 275 tctatcaaaagccctgacacggcctagaagctttttgttgttacgacaattgatcagaac 216
Query: 514 ctgggtgttgttcttaacactcatcattagtactgacagagggcctgtgctaaattcctc 573
||| |||||||| || ||||||||||| ||||| || || || || ||| | ||||||||
Sbjct: 215 ctgtgtgttgtttttcacactcatcatgagtacagatagtggaccagtgttgaattcctc 156
Query: 574 ttcctctttcttccc 588
|||||| ||||||||
Sbjct: 155 ttcctcattcttccc 141
>gb|CO512972.1|CO512972 s13dSG09A0800053_121870 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 81
Score = 32.2 bits (16), Expect = 0.49
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 574 ttcctctttcttccca 589
||||||||||||||||
Sbjct: 50 ttcctctttcttccca 65
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1248
Number of Sequences: 7669
Number of extensions: 1248
Number of successful extensions: 336
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 333
Number of HSP's gapped (non-prelim): 2
length of query: 687
length of database: 3,745,706
effective HSP length: 16
effective length of query: 671
effective length of database: 3,623,002
effective search space: 2431034342
effective search space used: 2431034342
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)