BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131543.2.11
(514 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO511931.1|CO511931 s13dSG05G0200020_103762 Glandular tr... 103 1e-022
gb|CO514409.1|CO514409 s13dSG36C0400024_327478 Glandular tr... 103 1e-022
gb|CO515008.1|CO515008 s13dSG26C0400034_397521 Glandular tr... 103 1e-022
gb|AW698347.1|AW698347 G78 glandular-haired subtracted cDNA... 32 0.36
gb|DQ122847.1| Medicago sativa clone NF6 putative imbibitio... 32 0.36
>gb|CO511931.1|CO511931 s13dSG05G0200020_103762 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 464
Score = 103 bits (52), Expect = 1e-022
Identities = 124/148 (83%)
Strand = Plus / Plus
Query: 110 agagatggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaa 169
||||||||| || |||||||| ||||| || ||||||||||| ||||| || ||||||||
Sbjct: 42 agagatggcgaaatcgaagaatcacaccgctcacaaccagtcttacaaagctcacaagaa 101
Query: 170 cggcatcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagtt 229
|||||||||||||| ||| | || || || || || ||||| |||||||| || |||||
Sbjct: 102 tggcatcaagaagccaaagaggcatcgtcacacttcaaccaaagggatggatccaaagtt 161
Query: 230 cctgaggaacctgaggtattcaaggaag 257
||||||||| ||||||| ||||||||
Sbjct: 162 tttgaggaaccagaggtatgcaaggaag 189
>gb|CO514409.1|CO514409 s13dSG36C0400024_327478 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 367
Score = 103 bits (52), Expect = 1e-022
Identities = 124/148 (83%)
Strand = Plus / Plus
Query: 110 agagatggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaa 169
||||||||| || |||||||| ||||| || ||||||||||| ||||| || ||||||||
Sbjct: 42 agagatggcgaaatcgaagaatcacaccgctcacaaccagtcttacaaagctcacaagaa 101
Query: 170 cggcatcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagtt 229
|||||||||||||| ||| | || || || || || ||||| |||||||| || |||||
Sbjct: 102 tggcatcaagaagccaaagaggcatcgtcacacttcaaccaaagggatggatccaaagtt 161
Query: 230 cctgaggaacctgaggtattcaaggaag 257
||||||||| ||||||| ||||||||
Sbjct: 162 tttgaggaaccagaggtatgcaaggaag 189
>gb|CO515008.1|CO515008 s13dSG26C0400034_397521 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 367
Score = 103 bits (52), Expect = 1e-022
Identities = 124/148 (83%)
Strand = Plus / Plus
Query: 110 agagatggccaagtcgaagaaccacacggcgcacaaccagtcgtacaaggcgcacaagaa 169
||||||||| || |||||||| ||||| || ||||||||||| ||||| || ||||||||
Sbjct: 42 agagatggcgaaatcgaagaatcacaccgctcacaaccagtcttacaaagctcacaagaa 101
Query: 170 cggcatcaagaagcccaagcgccaccggcagacctccaccaaggggatggaccccaagtt 229
|||||||||||||| ||| | || || || || || ||||| |||||||| || |||||
Sbjct: 102 tggcatcaagaagccaaagaggcatcgtcacacttcaaccaaagggatggatccaaagtt 161
Query: 230 cctgaggaacctgaggtattcaaggaag 257
||||||||| ||||||| ||||||||
Sbjct: 162 tttgaggaaccagaggtatgcaaggaag 189
>gb|AW698347.1|AW698347 G78 glandular-haired subtracted cDNA library Medicago sativa cDNA,
mRNA sequence
Length = 553
Score = 32.2 bits (16), Expect = 0.36
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 384 atgtttttatgataat 399
||||||||||||||||
Sbjct: 389 atgtttttatgataat 404
>gb|DQ122847.1| Medicago sativa clone NF6 putative imbibition protein
homolog/alkaline alpha galactosidase mRNA, partial cds
Length = 627
Score = 32.2 bits (16), Expect = 0.36
Identities = 16/16 (100%)
Strand = Plus / Plus
Query: 168 aacggcatcaagaagc 183
||||||||||||||||
Sbjct: 272 aacggcatcaagaagc 287
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1170
Number of Sequences: 7669
Number of extensions: 1170
Number of successful extensions: 299
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 294
Number of HSP's gapped (non-prelim): 5
length of query: 514
length of database: 3,745,706
effective HSP length: 16
effective length of query: 498
effective length of database: 3,623,002
effective search space: 1804254996
effective search space used: 1804254996
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)