BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.8
(708 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AJ410139.1|AJ410139 AJ410139 Medicago sativa library (Ka... 64 1e-010
gb|CO515737.1|CO515737 s13dSG77C0400034_419623 Glandular tr... 64 1e-010
gb|CO514107.1|CO514107 s13dSG75D0400030_156876 Glandular tr... 56 3e-008
gb|CO515466.1|CO515466 s13dSG51E0300023_417991 Glandular tr... 50 2e-006
gb|CO513408.1|CO513408 s13dSG38F1200095_129980 Glandular tr... 34 0.13
>gb|AJ410139.1|AJ410139 AJ410139 Medicago sativa library (Kalo P) Medicago sativa cDNA
clone U594, mRNA sequence
Length = 510
Score = 63.9 bits (32), Expect = 1e-010
Identities = 65/76 (85%)
Strand = Plus / Minus
Query: 380 tggcctcggcgtgctcccggcacttcacttcagtcgtggtacacatgaatgtttgcatgc 439
||||||| || |||||| |||||||||||| | ||||| || || |||||||||||||
Sbjct: 247 tggcctcagcatgctccttgcacttcacttctgatgtggtgcagataaatgtttgcatgc 188
Query: 440 acactttgcactggat 455
|||| |||||||||||
Sbjct: 187 acaccttgcactggat 172
>gb|CO515737.1|CO515737 s13dSG77C0400034_419623 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 541
Score = 63.9 bits (32), Expect = 1e-010
Identities = 65/76 (85%)
Strand = Plus / Minus
Query: 380 tggcctcggcgtgctcccggcacttcacttcagtcgtggtacacatgaatgtttgcatgc 439
||||||| || |||||| |||||||||||| | ||||| || || |||||||||||||
Sbjct: 268 tggcctcagcatgctccttgcacttcacttctgatgtggtgcagataaatgtttgcatgc 209
Query: 440 acactttgcactggat 455
|||| |||||||||||
Sbjct: 208 acaccttgcactggat 193
>gb|CO514107.1|CO514107 s13dSG75D0400030_156876 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 454
Score = 56.0 bits (28), Expect = 3e-008
Identities = 64/76 (84%)
Strand = Plus / Minus
Query: 380 tggcctcggcgtgctcccggcacttcacttcagtcgtggtacacatgaatgtttgcatgc 439
||||||| || |||||| |||||||||||| | ||||| || || |||||||||||||
Sbjct: 248 tggcctcagcatgctccttgcacttcacttctgatgtggtgcagataaatgtttgcatgc 189
Query: 440 acactttgcactggat 455
|||| | |||||||||
Sbjct: 188 acacctcgcactggat 173
>gb|CO515466.1|CO515466 s13dSG51E0300023_417991 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 228
Score = 50.1 bits (25), Expect = 2e-006
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 427 aatgtttgcatgcacactttgcactggat 455
||||||||||||||||| |||||||||||
Sbjct: 222 aatgtttgcatgcacaccttgcactggat 194
>gb|CO513408.1|CO513408 s13dSG38F1200095_129980 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 597
Score = 34.2 bits (17), Expect = 0.13
Identities = 17/17 (100%)
Strand = Plus / Plus
Query: 253 aacaccctcaacacaag 269
|||||||||||||||||
Sbjct: 256 aacaccctcaacacaag 272
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1079
Number of Sequences: 7669
Number of extensions: 1079
Number of successful extensions: 312
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 307
Number of HSP's gapped (non-prelim): 5
length of query: 708
length of database: 3,745,706
effective HSP length: 16
effective length of query: 692
effective length of database: 3,623,002
effective search space: 2507117384
effective search space used: 2507117384
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)