BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.387
(908 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|U83591.1|MSU83591 Medicago sativa class I chitinase mRNA... 54 2e-007
gb|U83592.1|MSU83592 Medicago sativa class I chitinase mRNA... 54 2e-007
gb|AY804254.1| Medicago sativa chitinase (Chi) mRNA, comple... 36 0.042
>gb|U83591.1|MSU83591 Medicago sativa class I chitinase mRNA, complete cds
Length = 1259
Score = 54.0 bits (27), Expect = 2e-007
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 773 cagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 497 cagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 439
Score = 36.2 bits (18), Expect = 0.042
Identities = 48/58 (82%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||| ||||| | || ||||||||||
Sbjct: 746 tggcaagatggcttaggtgactggggcgtcatccaaaaccatagagcggtcttgaagg 689
>gb|U83592.1|MSU83592 Medicago sativa class I chitinase mRNA, complete cds
Length = 1267
Score = 54.0 bits (27), Expect = 2e-007
Identities = 51/59 (86%)
Strand = Plus / Minus
Query: 773 cagtatccccaggcaaacggtccatccggagcagtcgcccatccaccggtggtttcgtg 831
||||||||||| ||| | || ||||| || ||||| ||||||||||| |||||||||||
Sbjct: 498 cagtatccccaagcatatgggccatcaggtgcagttgcccatccacctgtggtttcgtg 440
Score = 36.2 bits (18), Expect = 0.042
Identities = 48/58 (82%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||| ||||| | || ||||||||||
Sbjct: 747 tggcaagatggcttaggtgactggggcgtcatccaaaaccatagagcggtcttgaagg 690
>gb|AY804254.1| Medicago sativa chitinase (Chi) mRNA, complete cds
Length = 987
Score = 36.2 bits (18), Expect = 0.042
Identities = 48/58 (82%)
Strand = Plus / Minus
Query: 563 tggcacgagggcttgggcgactgcggcgtcatccagaaccagatggccgtcttgaagg 620
||||| || ||||| || ||||| ||||||||||| ||||| | || ||||||||||
Sbjct: 716 tggcaagatggcttaggtgactggggcgtcatccaaaaccatagagcggtcttgaagg 659
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1226
Number of Sequences: 7669
Number of extensions: 1226
Number of successful extensions: 359
Number of sequences better than 0.5: 3
Number of HSP's better than 0.5 without gapping: 3
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 353
Number of HSP's gapped (non-prelim): 6
length of query: 908
length of database: 3,745,706
effective HSP length: 16
effective length of query: 892
effective length of database: 3,623,002
effective search space: 3231717784
effective search space used: 3231717784
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 17 (34.2 bits)