BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= 131537.2.134
(674 letters)
Database: MedicagoSativa_nucl_with_EST.fasta
7669 sequences; 3,745,706 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CO516115.1|CO516115 s13dSG65E0500039_445558 Glandular tr... 82 6e-016
gb|CO516018.1|CO516018 s13dSG64A0200005_445364 Glandular tr... 76 4e-014
gb|CO513351.1|CO513351 s13dSG38A0300017_129866 Glandular tr... 68 9e-012
gb|CO516125.1|CO516125 s13dSG65F0900079_445578 Glandular tr... 50 2e-006
gb|CO514287.1|CO514287 s13dSG76F1000079_157236 Glandular tr... 40 0.002
>gb|CO516115.1|CO516115 s13dSG65E0500039_445558 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 403
Score = 81.8 bits (41), Expect = 6e-016
Identities = 95/113 (84%)
Strand = Plus / Minus
Query: 315 gcgagcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgag 374
||||||||||| ||||| || ||||||||| ||||||||| ||| |||||| |||
Sbjct: 357 gcgagcttctcaaagatatcattgatgaagctgttcatgatccccatagccttgcttgag 298
Query: 375 atgccaatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgta 427
|| || ||||| || || ||||||||||| |||||||||||||||||||||||
Sbjct: 297 ataccgatgtcaggatgaacctgcttgagaaccttgaagatgtagatcttgta 245
Score = 36.2 bits (18), Expect = 0.031
Identities = 24/26 (92%)
Strand = Plus / Minus
Query: 534 ggcttcttctccgcgggcttcttctc 559
||||||||||| ||||| ||||||||
Sbjct: 138 ggcttcttctctgcgggtttcttctc 113
Score = 32.2 bits (16), Expect = 0.48
Identities = 22/24 (91%)
Strand = Plus / Minus
Query: 269 gatggtgggcttcttgttgtagcg 292
|||||| || ||||||||||||||
Sbjct: 403 gatggtaggtttcttgttgtagcg 380
>gb|CO516018.1|CO516018 s13dSG64A0200005_445364 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 500
Score = 75.8 bits (38), Expect = 4e-014
Identities = 92/110 (83%)
Strand = Plus / Minus
Query: 318 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 377
||||||||||||||||| |||||||| ||||||||| |||||| ||| |||||
Sbjct: 381 agcttctcgaagatgtcattgatgaaactgttcatgatacccatggctttgcttgagata 322
Query: 378 ccaatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgta 427
|||||||| ||||| || || || || |||||||||||||||||||||||
Sbjct: 321 ccaatgtctgggtgaacttgtttcagaaccttgaagatgtagatcttgta 272
Score = 46.1 bits (23), Expect = 3e-005
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 521 cttctcctccgccggcttcttctccgcgggcttcttctc 559
||||||||| || || ||||||||||| |||||||||||
Sbjct: 145 cttctcctctgcgggtttcttctccgctggcttcttctc 107
Score = 42.1 bits (21), Expect = 5e-004
Identities = 39/45 (86%)
Strand = Plus / Minus
Query: 248 ggtctggatctcccgggaggtgatggtgggcttcttgttgtagcg 292
|||||| || |||| ||| ||||| || |||||||||||||||||
Sbjct: 451 ggtctgaatttccctggaagtgatagttggcttcttgttgtagcg 407
>gb|CO513351.1|CO513351 s13dSG38A0300017_129866 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 566
Score = 67.9 bits (34), Expect = 9e-012
Identities = 91/110 (82%)
Strand = Plus / Minus
Query: 318 agcttctcgaagatgtcgttgatgaaggagttcatgatggacatggccttggacgagatg 377
|||||||| ||||| || ||||||||| ||||||||| ||| |||||| |||||
Sbjct: 365 agcttctcaaagatatcattgatgaagctgttcatgatccccatagccttgcttgagata 306
Query: 378 ccaatgtccgggtgcacctgcttgagcaccttgaagatgtagatcttgta 427
|| ||||| || || ||||||||||| ||||||||||||||||||||||
Sbjct: 305 ccgatgtcaggatgaacctgcttgagacccttgaagatgtagatcttgta 256
Score = 50.1 bits (25), Expect = 2e-006
Identities = 91/113 (80%)
Strand = Plus / Minus
Query: 177 ttggtaaccgccttggtcccttcggatacggcgtgcttggcgagctcgccggggaggacg 236
|||||||| |||||||| || || || || || ||||||||||| || || || || ||
Sbjct: 506 ttggtaacagccttggttccctcagagacagcatgcttggcgagttcaccaggaagaaca 447
Query: 237 aggcgcaccgaggtctggatctcccgggaggtgatggtgggcttcttgttgta 289
|| || || | ||||| |||||||| ||||||||||| || |||||||||||
Sbjct: 446 agacgaacagcagtctgaatctcccgagaggtgatggtaggtttcttgttgta 394
Score = 36.2 bits (18), Expect = 0.031
Identities = 24/26 (92%)
Strand = Plus / Minus
Query: 534 ggcttcttctccgcgggcttcttctc 559
||||||||||| ||||| ||||||||
Sbjct: 150 ggcttcttctcagcgggtttcttctc 125
>gb|CO516125.1|CO516125 s13dSG65F0900079_445578 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 363
Score = 50.1 bits (25), Expect = 2e-006
Identities = 28/29 (96%)
Strand = Plus / Minus
Query: 315 gcgagcttctcgaagatgtcgttgatgaa 343
||||| |||||||||||||||||||||||
Sbjct: 48 gcgagtttctcgaagatgtcgttgatgaa 20
Score = 34.2 bits (17), Expect = 0.12
Identities = 35/41 (85%)
Strand = Plus / Minus
Query: 249 gtctggatctcccgggaggtgatggtgggcttcttgttgta 289
||||| || |||| ||| ||||| || ||||||||||||||
Sbjct: 114 gtctgaatttccctggaagtgattgttggcttcttgttgta 74
>gb|CO514287.1|CO514287 s13dSG76F1000079_157236 Glandular trichomes Medicago sativa cDNA,
mRNA sequence
Length = 521
Score = 40.1 bits (20), Expect = 0.002
Identities = 29/32 (90%)
Strand = Plus / Minus
Query: 534 ggcttcttctccgcgggcttcttctcggcctt 565
||||||||||||||||| ||||| || |||||
Sbjct: 111 ggcttcttctccgcgggtttcttttctgcctt 80
Score = 38.2 bits (19), Expect = 0.008
Identities = 22/23 (95%)
Strand = Plus / Minus
Query: 405 accttgaagatgtagatcttgta 427
|||||||||||||| ||||||||
Sbjct: 240 accttgaagatgtatatcttgta 218
Score = 38.2 bits (19), Expect = 0.008
Identities = 25/27 (92%)
Strand = Plus / Minus
Query: 494 cttctccgcccttggcttcttctcggc 520
|||||||||| |||| |||||||||||
Sbjct: 154 cttctccgcctttggtttcttctcggc 128
Score = 32.2 bits (16), Expect = 0.48
Identities = 19/20 (95%)
Strand = Plus / Minus
Query: 540 ttctccgcgggcttcttctc 559
||||| ||||||||||||||
Sbjct: 120 ttctctgcgggcttcttctc 101
Database: MedicagoSativa_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:23 PM
Number of letters in database: 3,745,706
Number of sequences in database: 7669
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1097
Number of Sequences: 7669
Number of extensions: 1097
Number of successful extensions: 330
Number of sequences better than 0.5: 5
Number of HSP's better than 0.5 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 302
Number of HSP's gapped (non-prelim): 25
length of query: 674
length of database: 3,745,706
effective HSP length: 16
effective length of query: 658
effective length of database: 3,623,002
effective search space: 2383935316
effective search space used: 2383935316
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 16 (32.2 bits)