BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCN21b10.yg.2.1
(574 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|BU973703.1|BU973703 HB25L04r BC Hordeum vulgare subsp. v... 163 8e-039
gb|AV833885.1|AV833885 AV833885 K. Sato unpublished cDNA li... 46 0.001
gb|BM376133.1|BM376133 EBma01_SQ002_H07_R maternal, 4 DPA, ... 42 0.020
gb|BM928833.1|BM928833 LP10006 Lemma/palea-enriched cDNA li... 40 0.078
gb|BM928834.1|BM928834 LP10007 Lemma/palea-enriched cDNA li... 40 0.078
gb|BM928843.1|BM928843 LP10030 Lemma/palea-enriched cDNA li... 40 0.078
gb|BM928858.1|BM928858 LP20059 Lemma/palea-enriched cDNA li... 40 0.078
gb|BQ134670.1|BQ134670 LP30108 Lemma/palea-enriched cDNA li... 40 0.078
gb|BQ134683.1|BQ134683 LP30159 Lemma/palea-enriched cDNA li... 40 0.078
gb|BM376088.2|BM376088 EBma01_SQ002_F01_R maternal, 4 DPA, ... 40 0.078
gb|BM376094.2|BM376094 EBma01_SQ002_F09_R maternal, 4 DPA, ... 40 0.078
gb|BM371381.2|BM371381 EBma08_SQ002_I05_R maternal, 28 DPA,... 40 0.078
gb|BM371382.2|BM371382 EBma08_SQ002_I06_R maternal, 28 DPA,... 40 0.078
gb|BM371429.2|BM371429 EBma08_SQ002_L04_R maternal, 28 DPA,... 40 0.078
gb|CD240764.1|CD240764 LP30021 Lemma/palea-enriched cDNA li... 40 0.078
gb|BM928867.1|BM928867 LP300020 Lemma/palea-enriched cDNA l... 38 0.31
>gb|BU973703.1|BU973703 HB25L04r BC Hordeum vulgare subsp. vulgare cDNA clone HB25L04
5-PRIME, mRNA sequence
Length = 464
Score = 163 bits (82), Expect = 8e-039
Identities = 121/134 (90%)
Strand = Plus / Plus
Query: 30 cgattctttgttgcactgaattcgaggaaggaggtcaatgtaatgttgaagaaagaagca 89
||||||||||||||||||||||| ||||| || ||||| || ||| |||||||||||||
Sbjct: 323 cgattctttgttgcactgaattcaaggaaagaagtcaacgtgatgctgaagaaagaagcc 382
Query: 90 gaatactttggagacattgtcattttgccatttatagaccgctatgagctggttgttctt 149
|||||||||||||| ||||||||||||||||||||||| || ||||| ||||| |||||
Sbjct: 383 gaatactttggagatattgtcattttgccatttatagatcgttatgaactggtagttctc 442
Query: 150 aagacaattgctat 163
||||||||||||||
Sbjct: 443 aagacaattgctat 456
>gb|AV833885.1|AV833885 AV833885 K. Sato unpublished cDNA library: Hordeum vulgare subsp.
vulgare shoots germination Hordeum vulgare subsp.
vulgare cDNA clone bags10a02, mRNA sequence
Length = 681
Score = 46.1 bits (23), Expect = 0.001
Identities = 38/43 (88%)
Strand = Plus / Minus
Query: 466 agatggaagatgtaagcatgggcctatgggtcgagaagttcaa 508
||||||||||||| ||||||||| | ||||| ||||| |||||
Sbjct: 507 agatggaagatgtcagcatgggcatgtgggtggagaaattcaa 465
>gb|BM376133.1|BM376133 EBma01_SQ002_H07_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ002_H07 5', mRNA sequence
Length = 422
Score = 42.1 bits (21), Expect = 0.020
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtacg 21
|||||||||||||||||||||
Sbjct: 360 gcggccgcccgggcaggtacg 340
>gb|BM928833.1|BM928833 LP10006 Lemma/palea-enriched cDNA library from elongation stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 1-6,
mRNA sequence
Length = 544
Score = 40.1 bits (20), Expect = 0.078
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 254 gcggccgcccgggcaggtac 273
Score = 40.1 bits (20), Expect = 0.078
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 261 gcggccgcccgggcaggtac 242
>gb|BM928834.1|BM928834 LP10007 Lemma/palea-enriched cDNA library from elongation stage
of kernel Hordeum vulgare subsp. vulgare cDNA clone
1-7, mRNA sequence
Length = 420
Score = 40.1 bits (20), Expect = 0.078
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 10 gcggccgcccgggcaggtac 29
>gb|BM928843.1|BM928843 LP10030 Lemma/palea-enriched cDNA library from elongation stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 1-30
similar to Cytosolic GA3PDH gene, mRNA sequence
Length = 478
Score = 40.1 bits (20), Expect = 0.078
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 283 gcggccgcccgggcaggtac 302
Score = 40.1 bits (20), Expect = 0.078
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 290 gcggccgcccgggcaggtac 271
>gb|BM928858.1|BM928858 LP20059 Lemma/palea-enriched cDNA library from gelatinous stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 2-59
similar to Rubisco small sub-unit gene, mRNA sequence
Length = 491
Score = 40.1 bits (20), Expect = 0.078
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 260 gcggccgcccgggcaggtac 241
>gb|BQ134670.1|BQ134670 LP30108 Lemma/palea-enriched cDNA library from dough stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 3-108,
mRNA sequence
Length = 530
Score = 40.1 bits (20), Expect = 0.078
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 347 gcggccgcccgggcaggtac 328
>gb|BQ134683.1|BQ134683 LP30159 Lemma/palea-enriched cDNA library from dough stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 3-159
similar to putative ABC transporter, mRNA sequence
Length = 339
Score = 40.1 bits (20), Expect = 0.078
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 281 gcggccgcccgggcaggtac 262
>gb|BM376088.2|BM376088 EBma01_SQ002_F01_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ002_F01 5', mRNA sequence
Length = 256
Score = 40.1 bits (20), Expect = 0.078
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 84 gcggccgcccgggcaggtac 103
>gb|BM376094.2|BM376094 EBma01_SQ002_F09_R maternal, 4 DPA, no treatment, cv Optic, EBma01
Hordeum vulgare subsp. vulgare cDNA clone
EBma01_SQ002_F09 5', mRNA sequence
Length = 387
Score = 40.1 bits (20), Expect = 0.078
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 353 gcggccgcccgggcaggtac 334
>gb|BM371381.2|BM371381 EBma08_SQ002_I05_R maternal, 28 DPA, no treatment, cv Optic, EBma08
Hordeum vulgare subsp. vulgare cDNA clone
EBma08_SQ002_I05 5', mRNA sequence
Length = 581
Score = 40.1 bits (20), Expect = 0.078
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 519 gcggccgcccgggcaggtac 500
>gb|BM371382.2|BM371382 EBma08_SQ002_I06_R maternal, 28 DPA, no treatment, cv Optic, EBma08
Hordeum vulgare subsp. vulgare cDNA clone
EBma08_SQ002_I06 5', mRNA sequence
Length = 494
Score = 40.1 bits (20), Expect = 0.078
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 433 gcggccgcccgggcaggtac 414
>gb|BM371429.2|BM371429 EBma08_SQ002_L04_R maternal, 28 DPA, no treatment, cv Optic, EBma08
Hordeum vulgare subsp. vulgare cDNA clone
EBma08_SQ002_L04 5', mRNA sequence
Length = 454
Score = 40.1 bits (20), Expect = 0.078
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 84 gcggccgcccgggcaggtac 103
>gb|CD240764.1|CD240764 LP30021 Lemma/palea-enriched cDNA library from dough stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 3-21
similar to A. thaliana AtRer1A, Accession No. AY044321,
mRNA sequence
Length = 342
Score = 40.1 bits (20), Expect = 0.078
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 1 gcggccgcccgggcaggtac 20
||||||||||||||||||||
Sbjct: 323 gcggccgcccgggcaggtac 342
Score = 38.2 bits (19), Expect = 0.31
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 1 gcggccgcccgggcaggta 19
|||||||||||||||||||
Sbjct: 330 gcggccgcccgggcaggta 312
>gb|BM928867.1|BM928867 LP300020 Lemma/palea-enriched cDNA library from dough stage of
kernel Hordeum vulgare subsp. vulgare cDNA clone 3-20,
mRNA sequence
Length = 216
Score = 38.2 bits (19), Expect = 0.31
Identities = 19/19 (100%)
Strand = Plus / Minus
Query: 2 cggccgcccgggcaggtac 20
|||||||||||||||||||
Sbjct: 212 cggccgcccgggcaggtac 194
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 39,347
Number of Sequences: 312970
Number of extensions: 39347
Number of successful extensions: 10357
Number of sequences better than 0.5: 16
Number of HSP's better than 0.5 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 10337
Number of HSP's gapped (non-prelim): 20
length of query: 574
length of database: 175,134,539
effective HSP length: 19
effective length of query: 555
effective length of database: 169,188,109
effective search space: 93899400495
effective search space used: 93899400495
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)