BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCI2h07.yg.2.1
(286 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|AV927219.1|AV927219 AV927219 K. Sato unpublished cDNA li... 167 2e-040
gb|BI949437.1|BI949437 HVSMEl0013O09f Hordeum vulgare spike... 163 4e-039
gb|BQ465804.1|BQ465804 HU04L18r HU Hordeum vulgare subsp. v... 159 6e-038
gb|BQ469182.1|BQ469182 HM03K08r HM Hordeum vulgare subsp. v... 159 6e-038
gb|BU971759.1|BU971759 HB19J12r BC Hordeum vulgare subsp. v... 159 6e-038
gb|CA025840.1|CA025840 HZ53E19r HZ Hordeum vulgare subsp. v... 159 6e-038
gb|BI955734.1|BI955734 HVSMEm0024E12f Hordeum vulgare green... 151 1e-035
gb|AV917031.1|AV917031 AV917031 K. Sato unpublished cDNA li... 147 2e-034
gb|AJ462437.1|AJ462437 AJ462437 S00002 Hordeum vulgare subs... 137 2e-031
gb|BG300950.1|BG300950 HVSMEb0019A22f Hordeum vulgare seedl... 82 1e-014
gb|AV925770.1|AV925770 AV925770 K. Sato unpublished cDNA li... 46 6e-004
gb|AV926207.1|AV926207 AV926207 K. Sato unpublished cDNA li... 46 6e-004
gb|AV930906.1|AV930906 AV930906 K. Sato unpublished cDNA li... 46 6e-004
gb|AV931092.1|AV931092 AV931092 K. Sato unpublished cDNA li... 46 6e-004
gb|AV931093.1|AV931093 AV931093 K. Sato unpublished cDNA li... 46 6e-004
gb|BQ468619.1|BQ468619 HM01M13T HM Hordeum vulgare subsp. v... 46 6e-004
gb|BI776485.2|BI776485 EBpi05_SQ001_J01_R pistil, 8 DPA, no... 46 6e-004
gb|BU967165.1|BU967165 HB03H16r BC Hordeum vulgare subsp. v... 46 6e-004
gb|BU967242.1|BU967242 HB03K11r BC Hordeum vulgare subsp. v... 46 6e-004
gb|BU986849.1|BU986849 HF13B10r HF Hordeum vulgare subsp. v... 46 6e-004
gb|BU988138.1|BU988138 HF16M09r HF Hordeum vulgare subsp. v... 46 6e-004
gb|CA025257.1|CA025257 HZ51J24r HZ Hordeum vulgare subsp. v... 46 6e-004
gb|CB860194.1|CB860194 HI12P13w HI Hordeum vulgare subsp. v... 46 6e-004
gb|CB876338.1|CB876338 HX10P19w HX Hordeum vulgare subsp. v... 46 6e-004
gb|BI958555.1|BI958555 HVSMEn0015J16f Hordeum vulgare rachi... 42 0.009
gb|BI959339.1|BI959339 HVSMEn0019E20f Hordeum vulgare rachi... 42 0.009
gb|BF259974.3|BF259974 HVSMEf0020M07f Hordeum vulgare seedl... 42 0.009
gb|BG343763.2|BG343763 HVSMEg0006L01f Hordeum vulgare pre-a... 42 0.009
gb|AV913277.1|AV913277 AV913277 K. Sato unpublished cDNA li... 42 0.009
gb|AV913278.1|AV913278 AV913278 K. Sato unpublished cDNA li... 42 0.009
gb|AV914152.1|AV914152 AV914152 K. Sato unpublished cDNA li... 42 0.009
gb|AV914933.1|AV914933 AV914933 K. Sato unpublished cDNA li... 42 0.009
gb|AV918571.1|AV918571 AV918571 K. Sato unpublished cDNA li... 42 0.009
gb|AV918572.1|AV918572 AV918572 K. Sato unpublished cDNA li... 42 0.009
gb|AV919198.1|AV919198 AV919198 K. Sato unpublished cDNA li... 42 0.009
gb|AV920051.1|AV920051 AV920051 K. Sato unpublished cDNA li... 42 0.009
gb|AV923333.1|AV923333 AV923333 K. Sato unpublished cDNA li... 42 0.009
gb|AV925215.1|AV925215 AV925215 K. Sato unpublished cDNA li... 42 0.009
gb|AV928513.1|AV928513 AV928513 K. Sato unpublished cDNA li... 42 0.009
gb|AV930365.1|AV930365 AV930365 K. Sato unpublished cDNA li... 42 0.009
gb|AV934882.1|AV934882 AV934882 K. Sato unpublished cDNA li... 42 0.009
gb|AV936150.1|AV936150 AV936150 K. Sato unpublished cDNA li... 42 0.009
gb|BM816138.1|BM816138 HC109B12_T3.ab1 HC Hordeum vulgare s... 42 0.009
gb|BM816139.1|BM816139 HC105G09_T3.ab1 HC Hordeum vulgare s... 42 0.009
gb|BJ466285.1|BJ466285 BJ466285 K. Sato unpublished cDNA li... 42 0.009
gb|BQ465284.1|BQ465284 HU03C22r HU Hordeum vulgare subsp. v... 42 0.009
gb|BQ660846.1|BQ660846 HI05L24u HI Hordeum vulgare subsp. v... 42 0.009
gb|BM370580.2|BM370580 EBro08_SQ004_K11_R root, 3 week, dro... 42 0.009
gb|BQ766406.1|BQ766406 EBro08_SQ005_L20_R root, 3 week, dro... 42 0.009
gb|BU990492.1|BU990492 HF25D10r HF Hordeum vulgare subsp. v... 42 0.009
gb|CA017356.1|CA017356 HV12L21u HV Hordeum vulgare subsp. v... 40 0.037
>gb|AV927219.1|AV927219 AV927219 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd1a04 3', mRNA sequence
Length = 588
Score = 167 bits (84), Expect = 2e-040
Identities = 216/263 (82%)
Strand = Plus / Minus
Query: 21 attggaggcgtgtcttcacatctctttgctgtgttccagggactactcaagnnnatagct 80
|||||||| || ||| | ||||| ||||| |||||||| ||||| |||||| ||||||
Sbjct: 547 attggaggtgtctctgcccatctatttgccgtgttccaaggacttctcaaggtgatagct 488
Query: 81 ggtgtagacacgagcttcactgtgacatccaagggcggagacgacgaggagttctcagag 140
||||| ||||| |||||||| || ||| | |||| |||||| || |||||||| || |||
Sbjct: 487 ggtgtggacactagcttcaccgtcacaacaaaggccggagatgatgaggagttttctgag 428
Query: 141 ctctacacattcaaatggacgacccttctgatacctccgacaaccctgctcctactgaac 200
|| ||||||||||||||||| ||| | |||| || ||||| |||||||| || ||||||
Sbjct: 427 ctgtacacattcaaatggacaaccttgttgattcccccgaccaccctgcttctgctgaac 368
Query: 201 ttcattggagtggtagctggcattnnnaatgcgatcannnacggatatgaatcatggggc 260
||||| || ||||| |||||||| || || |||| |||||||||||||||||||
Sbjct: 367 ttcatcggtgtggttgctggcatctccaacgcaatcaacaacggatatgaatcatggggg 308
Query: 261 cccctgttcgggaagctcttctt 283
|| || |||||||||||||||||
Sbjct: 307 cctctcttcgggaagctcttctt 285
>gb|BI949437.1|BI949437 HVSMEl0013O09f Hordeum vulgare spike EST library HVcDNA0012
(Fusarium infected) Hordeum vulgare subsp. vulgare cDNA
clone HVSMEl0013O09f, mRNA sequence
Length = 938
Score = 163 bits (82), Expect = 4e-039
Identities = 202/245 (82%)
Strand = Plus / Plus
Query: 39 catctctttgctgtgttccagggactactcaagnnnatagctggtgtagacacgagcttc 98
||||| ||||| |||||||| ||||| |||||| ||||||||||| ||||| ||||||
Sbjct: 13 catctatttgccgtgttccaaggacttctcaaggtgatagctggtgtggacactagcttc 72
Query: 99 actgtgacatccaagggcggagacgacgaggagttctcagagctctacacattcaaatgg 158
|| || ||| | |||| |||||| || |||||||| || ||||| |||||||||||||||
Sbjct: 73 accgtcacaacaaaggccggagatgatgaggagttttctgagctgtacacattcaaatgg 132
Query: 159 acgacccttctgatacctccgacaaccctgctcctactgaacttcattggagtggtagct 218
|| ||| | |||| || ||||| |||||||| || ||||||||||| || ||||| |||
Sbjct: 133 acaaccttgttgattcccccgaccaccctgcttctgctgaacttcatcggtgtggttgct 192
Query: 219 ggcattnnnaatgcgatcannnacggatatgaatcatggggccccctgttcgggaagctc 278
||||| || || |||| ||||||||||||||||||| || || ||||||||||||
Sbjct: 193 ggcatctccaacgcaatcaacaacggatatgaatcatgggggcctctcttcgggaagctc 252
Query: 279 ttctt 283
|||||
Sbjct: 253 ttctt 257
>gb|BQ465804.1|BQ465804 HU04L18r HU Hordeum vulgare subsp. vulgare cDNA clone HU04L18
5-PRIME, mRNA sequence
Length = 644
Score = 159 bits (80), Expect = 6e-038
Identities = 215/263 (81%)
Strand = Plus / Plus
Query: 21 attggaggcgtgtcttcacatctctttgctgtgttccagggactactcaagnnnatagct 80
|||||||| || ||| | ||||| ||||| |||||||| ||||| |||||| ||||||
Sbjct: 349 attggaggtgtctctgcccatctatttgccgtgttccaaggacttctcaaggtgatagct 408
Query: 81 ggtgtagacacgagcttcactgtgacatccaagggcggagacgacgaggagttctcagag 140
||||| ||||| |||||||| || ||| | |||| |||||| || |||||||| || |||
Sbjct: 409 ggtgtggacactagcttcaccgtcacaacaaaggccggagatgatgaggagttttctgag 468
Query: 141 ctctacacattcaaatggacgacccttctgatacctccgacaaccctgctcctactgaac 200
|| || |||||||||||||| ||| | |||| || ||||| |||||||| || ||||||
Sbjct: 469 ctgtatacattcaaatggacaaccttgttgattcccccgaccaccctgcttctgctgaac 528
Query: 201 ttcattggagtggtagctggcattnnnaatgcgatcannnacggatatgaatcatggggc 260
||||| || ||||| |||||||| || || |||| |||||||||||||||||||
Sbjct: 529 ttcatcggtgtggttgctggcatctccaacgcaatcaacaacggatatgaatcatggggg 588
Query: 261 cccctgttcgggaagctcttctt 283
|| || |||||||||||||||||
Sbjct: 589 cctctcttcgggaagctcttctt 611
>gb|BQ469182.1|BQ469182 HM03K08r HM Hordeum vulgare subsp. vulgare cDNA clone HM03K08
5-PRIME, mRNA sequence
Length = 660
Score = 159 bits (80), Expect = 6e-038
Identities = 215/263 (81%)
Strand = Plus / Plus
Query: 21 attggaggcgtgtcttcacatctctttgctgtgttccagggactactcaagnnnatagct 80
|||||||| || ||| | ||||| ||||| |||||||| ||||| |||||| ||||||
Sbjct: 374 attggaggtgtctctgcccatctatttgccgtgttccaaggacttctcaaggtgatagct 433
Query: 81 ggtgtagacacgagcttcactgtgacatccaagggcggagacgacgaggagttctcagag 140
||||| ||||| |||||||| || ||| | |||| |||||| || |||||||| || |||
Sbjct: 434 ggtgtggacactagcttcaccgtcacaacaaaggccggagatgatgaggagttttctgag 493
Query: 141 ctctacacattcaaatggacgacccttctgatacctccgacaaccctgctcctactgaac 200
|| || |||||||||||||| ||| | |||| || ||||| |||||||| || ||||||
Sbjct: 494 ctgtatacattcaaatggacaaccttgttgattcccccgaccaccctgcttctgctgaac 553
Query: 201 ttcattggagtggtagctggcattnnnaatgcgatcannnacggatatgaatcatggggc 260
||||| || ||||| |||||||| || || |||| |||||||||||||||||||
Sbjct: 554 ttcatcggtgtggttgctggcatctccaacgcaatcaacaacggatatgaatcatggggg 613
Query: 261 cccctgttcgggaagctcttctt 283
|| || |||||||||||||||||
Sbjct: 614 cctctcttcgggaagctcttctt 636
>gb|BU971759.1|BU971759 HB19J12r BC Hordeum vulgare subsp. vulgare cDNA clone HB19J12
5-PRIME, mRNA sequence
Length = 649
Score = 159 bits (80), Expect = 6e-038
Identities = 215/263 (81%)
Strand = Plus / Plus
Query: 21 attggaggcgtgtcttcacatctctttgctgtgttccagggactactcaagnnnatagct 80
|||||||| || ||| | ||||| ||||| |||||||| ||||| |||||| ||||||
Sbjct: 241 attggaggtgtctctgcccatctatttgccgtgttccaaggacttctcaaggtgatagct 300
Query: 81 ggtgtagacacgagcttcactgtgacatccaagggcggagacgacgaggagttctcagag 140
||||| ||||| |||||||| || ||| | |||| |||||| || |||||||| || |||
Sbjct: 301 ggtgtggacactagcttcaccgtcacaacaaaggccggagatgatgaggagttttctgag 360
Query: 141 ctctacacattcaaatggacgacccttctgatacctccgacaaccctgctcctactgaac 200
|| || |||||||||||||| ||| | |||| || ||||| |||||||| || ||||||
Sbjct: 361 ctgtatacattcaaatggacaaccttgttgattcccccgaccaccctgcttctgctgaac 420
Query: 201 ttcattggagtggtagctggcattnnnaatgcgatcannnacggatatgaatcatggggc 260
||||| || ||||| |||||||| || || |||| |||||||||||||||||||
Sbjct: 421 ttcatcggtgtggttgctggcatctccaacgcaatcaacaacggatatgaatcatggggg 480
Query: 261 cccctgttcgggaagctcttctt 283
|| || |||||||||||||||||
Sbjct: 481 cctctcttcgggaagctcttctt 503
>gb|CA025840.1|CA025840 HZ53E19r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ53E19
5-PRIME, mRNA sequence
Length = 456
Score = 159 bits (80), Expect = 6e-038
Identities = 215/263 (81%)
Strand = Plus / Plus
Query: 21 attggaggcgtgtcttcacatctctttgctgtgttccagggactactcaagnnnatagct 80
|||||||| || ||| | ||||| ||||| |||||||| ||||| |||||| ||||||
Sbjct: 39 attggaggtgtctctgcccatctatttgccgtgttccaaggacttctcaaggtgatagct 98
Query: 81 ggtgtagacacgagcttcactgtgacatccaagggcggagacgacgaggagttctcagag 140
||||| ||||| |||||||| || ||| | |||| |||||| || |||||||| || |||
Sbjct: 99 ggtgtggacactagcttcaccgtcacaacaaaggccggagatgatgaggagttttctgag 158
Query: 141 ctctacacattcaaatggacgacccttctgatacctccgacaaccctgctcctactgaac 200
|| || |||||||||||||| ||| | |||| || ||||| |||||||| || ||||||
Sbjct: 159 ctgtatacattcaaatggacaaccttgttgattcccccgaccaccctgcttctgctgaac 218
Query: 201 ttcattggagtggtagctggcattnnnaatgcgatcannnacggatatgaatcatggggc 260
||||| || ||||| |||||||| || || |||| |||||||||||||||||||
Sbjct: 219 ttcatcggtgtggttgctggcatctccaacgcaatcaacaacggatatgaatcatggggg 278
Query: 261 cccctgttcgggaagctcttctt 283
|| || |||||||||||||||||
Sbjct: 279 cctctcttcgggaagctcttctt 301
>gb|BI955734.1|BI955734 HVSMEm0024E12f Hordeum vulgare green seedling EST library
HVcDNA0014 (Blumeria infected) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEm0024E12f, mRNA sequence
Length = 707
Score = 151 bits (76), Expect = 1e-035
Identities = 214/263 (81%)
Strand = Plus / Plus
Query: 21 attggaggcgtgtcttcacatctctttgctgtgttccagggactactcaagnnnatagct 80
|||||||| || ||| | ||||| ||||| |||||||| ||||| |||||| ||||||
Sbjct: 17 attggaggtgtctctgcccatctatttgccgtgttccaaggacttctcaaggtgatagct 76
Query: 81 ggtgtagacacgagcttcactgtgacatccaagggcggagacgacgaggagttctcagag 140
||||| ||||| |||||||| || ||| | |||| |||||| || |||||||| || |||
Sbjct: 77 ggtgtggacactagcttcaccgtcacaacaaaggccggagatgatgaggagttttctgag 136
Query: 141 ctctacacattcaaatggacgacccttctgatacctccgacaaccctgctcctactgaac 200
|| ||||||||||||||||| ||| | |||| | |||| |||||||| || ||||||
Sbjct: 137 ctgtacacattcaaatggacaaccttgttgatggcggcgaccaccctgcttctgctgaac 196
Query: 201 ttcattggagtggtagctggcattnnnaatgcgatcannnacggatatgaatcatggggc 260
||||| || ||||| |||||||| || || |||| |||||||||||||||||||
Sbjct: 197 ttcatcggtgtggttgctggcatctccaacgcaatcaacaacggatatgaatcatggggg 256
Query: 261 cccctgttcgggaagctcttctt 283
|| || |||||||||||||||||
Sbjct: 257 cctctcttcgggaagctcttctt 279
>gb|AV917031.1|AV917031 AV917031 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags20i09 5', mRNA sequence
Length = 579
Score = 147 bits (74), Expect = 2e-034
Identities = 185/225 (82%)
Strand = Plus / Plus
Query: 59 gggactactcaagnnnatagctggtgtagacacgagcttcactgtgacatccaagggcgg 118
|||||| |||||| ||||||||||| ||||| |||||||| || ||| | |||| |||
Sbjct: 1 gggacttctcaaggtgatagctggtgtggacactagcttcaccgtcacaacaaaggccgg 60
Query: 119 agacgacgaggagttctcagagctctacacattcaaatggacgacccttctgatacctcc 178
||| || |||||||| || ||||| ||||||||||||||||| ||| | |||| || ||
Sbjct: 61 agatgatgaggagttttctgagctgtacacattcaaatggacaaccttgttgattccccc 120
Query: 179 gacaaccctgctcctactgaacttcattggagtggtagctggcattnnnaatgcgatcan 238
||| |||||||| || ||||||||||| || ||||| |||||||| || || ||||
Sbjct: 121 gaccaccctgcttctgctgaacttcatcggtgtggttgctggcatctccaacgcaatcaa 180
Query: 239 nnacggatatgaatcatggggccccctgttcgggaagctcttctt 283
||||||||||||||||||| || || |||||||||||||||||
Sbjct: 181 caacggatatgaatcatgggggcctctcttcgggaagctcttctt 225
>gb|AJ462437.1|AJ462437 AJ462437 S00002 Hordeum vulgare subsp. vulgare cDNA clone
S0000200081H04F1, mRNA sequence
Length = 360
Score = 137 bits (69), Expect = 2e-031
Identities = 183/224 (81%)
Strand = Plus / Plus
Query: 60 ggactactcaagnnnatagctggtgtagacacgagcttcactgtgacatccaagggcgga 119
||||| |||||| ||||||||||| ||||| |||||||| || ||| | |||| ||||
Sbjct: 5 ggacttctcaaggtgatagctggtgtggacactagcttcaccgtcacaacaaaggccgga 64
Query: 120 gacgacgaggagttctcagagctctacacattcaaatggacgacccttctgatacctccg 179
|| || |||||||| || ||||| || |||||||||||||| ||| | |||| || |||
Sbjct: 65 gatgatgaggagttttctgagctgtatacattcaaatggacaaccttgttgattcccccg 124
Query: 180 acaaccctgctcctactgaacttcattggagtggtagctggcattnnnaatgcgatcann 239
|| |||||||| || ||||||||||| || ||||| |||||||| || || ||||
Sbjct: 125 accaccctgcttctgctgaacttcatcggtgtggttgctggcatctccaacgcaatcaac 184
Query: 240 nacggatatgaatcatggggccccctgttcgggaagctcttctt 283
||||||||||||||||||| || || |||||||||||||||||
Sbjct: 185 aacggatatgaatcatgggggcctctcttcgggaagctcttctt 228
>gb|BG300950.1|BG300950 HVSMEb0019A22f Hordeum vulgare seedling shoot EST library
HVcDNA0002 (Dehydration stress) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEb0019A22f, mRNA sequence
Length = 619
Score = 81.8 bits (41), Expect = 1e-014
Identities = 89/107 (83%)
Strand = Plus / Plus
Query: 177 ccgacaaccctgctcctactgaacttcattggagtggtagctggcattnnnaatgcgatc 236
||||| |||||||| || ||||||||||| || ||||| |||||||| || || |||
Sbjct: 10 ccgaccaccctgcttctgctgaacttcatcggtgtggttgctggcatctccaacgcaatc 69
Query: 237 annnacggatatgaatcatggggccccctgttcgggaagctcttctt 283
| ||||||||||||||||||| || || |||||||||||||||||
Sbjct: 70 aacaacggatatgaatcatgggggcctctcttcgggaagctcttctt 116
>gb|AV925770.1|AV925770 AV925770 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd25l19 5', mRNA sequence
Length = 425
Score = 46.1 bits (23), Expect = 6e-004
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 252 tcatggggccccctgttcgggaagctcttctttgc 286
|||||||| || || ||||||||||||||||||||
Sbjct: 366 tcatggggaccgcttttcgggaagctcttctttgc 400
>gb|AV926207.1|AV926207 AV926207 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd18i05 5', mRNA sequence
Length = 668
Score = 46.1 bits (23), Expect = 6e-004
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 252 tcatggggccccctgttcgggaagctcttctttgc 286
|||||||| || || ||||||||||||||||||||
Sbjct: 633 tcatggggaccgcttttcgggaagctcttctttgc 667
>gb|AV930906.1|AV930906 AV930906 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd25l19 3', mRNA sequence
Length = 505
Score = 46.1 bits (23), Expect = 6e-004
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 252 tcatggggccccctgttcgggaagctcttctttgc 286
|||||||| || || ||||||||||||||||||||
Sbjct: 319 tcatggggaccgcttttcgggaagctcttctttgc 285
>gb|AV931092.1|AV931092 AV931092 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd18i05 3', mRNA sequence
Length = 658
Score = 46.1 bits (23), Expect = 6e-004
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 252 tcatggggccccctgttcgggaagctcttctttgc 286
|||||||| || || ||||||||||||||||||||
Sbjct: 375 tcatggggaccgcttttcgggaagctcttctttgc 341
>gb|AV931093.1|AV931093 AV931093 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd18i06 3', mRNA sequence
Length = 658
Score = 46.1 bits (23), Expect = 6e-004
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 252 tcatggggccccctgttcgggaagctcttctttgc 286
|||||||| || || ||||||||||||||||||||
Sbjct: 382 tcatggggaccgcttttcgggaagctcttctttgc 348
>gb|BQ468619.1|BQ468619 HM01M13T HM Hordeum vulgare subsp. vulgare cDNA clone HM01M13
5-PRIME, mRNA sequence
Length = 653
Score = 46.1 bits (23), Expect = 6e-004
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 252 tcatggggccccctgttcgggaagctcttctttgc 286
|||||||| || || ||||||||||||||||||||
Sbjct: 387 tcatggggaccgcttttcgggaagctcttctttgc 421
>gb|BI776485.2|BI776485 EBpi05_SQ001_J01_R pistil, 8 DPA, no treatment, cv Optic, EBpi05
Hordeum vulgare subsp. vulgare cDNA clone
EBpi05_SQ001_J01 5', mRNA sequence
Length = 518
Score = 46.1 bits (23), Expect = 6e-004
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 252 tcatggggccccctgttcgggaagctcttctttgc 286
|||||||| || || ||||||||||||||||||||
Sbjct: 298 tcatggggaccgcttttcgggaagctcttctttgc 332
>gb|BU967165.1|BU967165 HB03H16r BC Hordeum vulgare subsp. vulgare cDNA clone HB03H16
5-PRIME, mRNA sequence
Length = 471
Score = 46.1 bits (23), Expect = 6e-004
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 252 tcatggggccccctgttcgggaagctcttctttgc 286
|||||||| || || ||||||||||||||||||||
Sbjct: 68 tcatggggaccgcttttcgggaagctcttctttgc 102
>gb|BU967242.1|BU967242 HB03K11r BC Hordeum vulgare subsp. vulgare cDNA clone HB03K11
5-PRIME, mRNA sequence
Length = 577
Score = 46.1 bits (23), Expect = 6e-004
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 252 tcatggggccccctgttcgggaagctcttctttgc 286
|||||||| || || ||||||||||||||||||||
Sbjct: 292 tcatggggaccgcttttcgggaagctcttctttgc 326
>gb|BU986849.1|BU986849 HF13B10r HF Hordeum vulgare subsp. vulgare cDNA clone HF13B10
5-PRIME, mRNA sequence
Length = 622
Score = 46.1 bits (23), Expect = 6e-004
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 252 tcatggggccccctgttcgggaagctcttctttgc 286
|||||||| || || ||||||||||||||||||||
Sbjct: 459 tcatggggaccgcttttcgggaagctcttctttgc 493
>gb|BU988138.1|BU988138 HF16M09r HF Hordeum vulgare subsp. vulgare cDNA clone HF16M09
5-PRIME, mRNA sequence
Length = 643
Score = 46.1 bits (23), Expect = 6e-004
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 252 tcatggggccccctgttcgggaagctcttctttgc 286
|||||||| || || ||||||||||||||||||||
Sbjct: 556 tcatggggaccgcttttcgggaagctcttctttgc 590
>gb|CA025257.1|CA025257 HZ51J24r HZ Hordeum vulgare subsp. vulgare cDNA clone HZ51J24
5-PRIME, mRNA sequence
Length = 463
Score = 46.1 bits (23), Expect = 6e-004
Identities = 32/35 (91%)
Strand = Plus / Plus
Query: 252 tcatggggccccctgttcgggaagctcttctttgc 286
|||||||| || || ||||||||||||||||||||
Sbjct: 376 tcatggggaccgcttttcgggaagctcttctttgc 410
>gb|CB860194.1|CB860194 HI12P13w HI Hordeum vulgare subsp. vulgare cDNA clone HI12P13
3-PRIME, mRNA sequence
Length = 651
Score = 46.1 bits (23), Expect = 6e-004
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 252 tcatggggccccctgttcgggaagctcttctttgc 286
|||||||| || || ||||||||||||||||||||
Sbjct: 375 tcatggggaccgcttttcgggaagctcttctttgc 341
>gb|CB876338.1|CB876338 HX10P19w HX Hordeum vulgare subsp. vulgare cDNA clone HX10P19
3-PRIME, mRNA sequence
Length = 616
Score = 46.1 bits (23), Expect = 6e-004
Identities = 32/35 (91%)
Strand = Plus / Minus
Query: 252 tcatggggccccctgttcgggaagctcttctttgc 286
|||||||| || || ||||||||||||||||||||
Sbjct: 318 tcatggggaccgcttttcgggaagctcttctttgc 284
>gb|BI958555.1|BI958555 HVSMEn0015J16f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0015J16f, mRNA sequence
Length = 631
Score = 42.1 bits (21), Expect = 0.009
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 255 tggggccccctgttcgggaagctcttctt 283
|||||||| || |||||||||||||||||
Sbjct: 433 tggggcccgctcttcgggaagctcttctt 405
>gb|BI959339.1|BI959339 HVSMEn0019E20f Hordeum vulgare rachis EST library HVcDNA0015
(normal) Hordeum vulgare subsp. vulgare cDNA clone
HVSMEn0019E20f, mRNA sequence
Length = 681
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 559 aatcttgggggccgctcttcgggaagctcttctttgc 523
>gb|BF259974.3|BF259974 HVSMEf0020M07f Hordeum vulgare seedling root EST library HVcDNA0007
(Etiolated and unstressed) Hordeum vulgare subsp.
vulgare cDNA clone HVSMEf0020M07f, mRNA sequence
Length = 533
Score = 42.1 bits (21), Expect = 0.009
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 255 tggggccccctgttcgggaagctcttctt 283
|||||||| || |||||||||||||||||
Sbjct: 369 tggggcccgctcttcgggaagctcttctt 397
>gb|BG343763.2|BG343763 HVSMEg0006L01f Hordeum vulgare pre-anthesis spike EST library
HVcDNA0008 (white to yellow anther) Hordeum vulgare
subsp. vulgare cDNA clone HVSMEg0006L01f, mRNA sequence
Length = 500
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 1 aatcttgggggccgctcttcgggaagctcttctttgc 37
>gb|AV913277.1|AV913277 AV913277 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags21i03 5', mRNA sequence
Length = 631
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 275 aatcttgggggccgctcttcgggaagctcttctttgc 311
>gb|AV913278.1|AV913278 AV913278 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags21i04 5', mRNA sequence
Length = 604
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 274 aatcttgggggccgctcttcgggaagctcttctttgc 310
>gb|AV914152.1|AV914152 AV914152 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags4p09 5', mRNA sequence
Length = 583
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 455 aatcttgggggccgctcttcgggaagctcttctttgc 491
>gb|AV914933.1|AV914933 AV914933 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags9b06 5', mRNA sequence
Length = 654
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 456 aatcttgggggccgctcttcgggaagctcttctttgc 492
>gb|AV918571.1|AV918571 AV918571 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags21i03 3', mRNA sequence
Length = 598
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 521 aatcttgggggccgctcttcgggaagctcttctttgc 485
>gb|AV918572.1|AV918572 AV918572 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags21i04 3', mRNA sequence
Length = 649
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 481 aatcttgggggccgctcttcgggaagctcttctttgc 445
>gb|AV919198.1|AV919198 AV919198 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags4p09 3', mRNA sequence
Length = 631
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 538 aatcttgggggccgctcttcgggaagctcttctttgc 502
>gb|AV920051.1|AV920051 AV920051 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags9b06 3', mRNA sequence
Length = 680
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 538 aatcttgggggccgctcttcgggaagctcttctttgc 502
>gb|AV923333.1|AV923333 AV923333 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd12l12 5', mRNA sequence
Length = 656
Score = 42.1 bits (21), Expect = 0.009
Identities = 27/29 (93%)
Strand = Plus / Plus
Query: 255 tggggccccctgttcgggaagctcttctt 283
|||||||| || |||||||||||||||||
Sbjct: 497 tggggcccgctcttcgggaagctcttctt 525
>gb|AV925215.1|AV925215 AV925215 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd22e04 5', mRNA sequence
Length = 656
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 463 aatcttgggggccgctcttcgggaagctcttctttgc 499
>gb|AV928513.1|AV928513 AV928513 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basdl12 3', mRNA sequence
Length = 661
Score = 42.1 bits (21), Expect = 0.009
Identities = 27/29 (93%)
Strand = Plus / Minus
Query: 255 tggggccccctgttcgggaagctcttctt 283
|||||||| || |||||||||||||||||
Sbjct: 388 tggggcccgctcttcgggaagctcttctt 360
>gb|AV930365.1|AV930365 AV930365 K. Sato unpublished cDNA library, cv. Haruna Nijo second
leaf stage seedling leaves Hordeum vulgare subsp.
vulgare cDNA clone basd22e04 3', mRNA sequence
Length = 604
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 404 aatcttgggggccgctcttcgggaagctcttctttgc 368
>gb|AV934882.1|AV934882 AV934882 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal2a04 3', mRNA sequence
Length = 650
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 538 aatcttgggggccgctcttcgggaagctcttctttgc 502
>gb|AV936150.1|AV936150 AV936150 K. Sato unpublished cDNA library, cv. Haruna Nijo adult,
heading stage top three leaves Hordeum vulgare subsp.
vulgare cDNA clone baal10e13 3', mRNA sequence
Length = 616
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 524 aatcttgggggccgctcttcgggaagctcttctttgc 488
>gb|BM816138.1|BM816138 HC109B12_T3.ab1 HC Hordeum vulgare subsp. vulgare cDNA clone
HC109B12_T3.ab1 similar to (AF200528) cellulose
synthase-4 [Zea mays],(AF200529) cellulose synthase-5
[Zea mays],(AF200533) cellulose synthase-9 [Zea
mays],cellulose synthase catalytic subunit [Arabidopsis
thaliana],unnamed protein product [Arabidopsis
thaliana],, mRNA sequence
Length = 880
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 654 aatcttgggggccgctcttcgggaagctcttctttgc 690
>gb|BM816139.1|BM816139 HC105G09_T3.ab1 HC Hordeum vulgare subsp. vulgare cDNA clone
HC105G09_T3.ab1 similar to (AF200528) cellulose
synthase-4 [Zea mays],(AF200529) cellulose synthase-5
[Zea mays],(AF200533) cellulose synthase-9 [Zea
mays],cellulose synthase catalytic subunit [Arabidopsis
thaliana],unnamed protein product [Arabidopsis
thaliana],, mRNA sequence
Length = 916
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 416 aatcttgggggccgctcttcgggaagctcttctttgc 452
>gb|BJ466285.1|BJ466285 BJ466285 K. Sato unpublished cDNA library, cv. Haruna Nijo
germination shoots Hordeum vulgare subsp. vulgare cDNA
clone bags31h15 3', mRNA sequence
Length = 669
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 497 aatcttgggggccgctcttcgggaagctcttctttgc 461
>gb|BQ465284.1|BQ465284 HU03C22r HU Hordeum vulgare subsp. vulgare cDNA clone HU03C22
5-PRIME, mRNA sequence
Length = 643
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 273 aatcttgggggccgctcttcgggaagctcttctttgc 309
>gb|BQ660846.1|BQ660846 HI05L24u HI Hordeum vulgare subsp. vulgare cDNA clone HI05L24
3-PRIME, mRNA sequence
Length = 539
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Minus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 395 aatcttgggggccgctcttcgggaagctcttctttgc 359
>gb|BM370580.2|BM370580 EBro08_SQ004_K11_R root, 3 week, drought-stressed, cv Optic, EBro08
Hordeum vulgare subsp. vulgare cDNA clone
EBro08_SQ004_K11 5', mRNA sequence
Length = 606
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 35 aatcttgggggccgctcttcgggaagctcttctttgc 71
>gb|BQ766406.1|BQ766406 EBro08_SQ005_L20_R root, 3 week, drought-stressed, cv Optic, EBro08
Hordeum vulgare subsp. vulgare cDNA clone
EBro08_SQ005_L20 5', mRNA sequence
Length = 538
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 63 aatcttgggggccgctcttcgggaagctcttctttgc 99
>gb|BU990492.1|BU990492 HF25D10r HF Hordeum vulgare subsp. vulgare cDNA clone HF25D10
5-PRIME, mRNA sequence
Length = 621
Score = 42.1 bits (21), Expect = 0.009
Identities = 33/37 (89%)
Strand = Plus / Plus
Query: 250 aatcatggggccccctgttcgggaagctcttctttgc 286
|||| ||||| || || ||||||||||||||||||||
Sbjct: 295 aatcttgggggccgctcttcgggaagctcttctttgc 331
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 20,389
Number of Sequences: 312970
Number of extensions: 20389
Number of successful extensions: 6065
Number of sequences better than 0.5: 51
Number of HSP's better than 0.5 without gapping: 51
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 5986
Number of HSP's gapped (non-prelim): 68
length of query: 286
length of database: 175,134,539
effective HSP length: 18
effective length of query: 268
effective length of database: 169,501,079
effective search space: 45426289172
effective search space used: 45426289172
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)