BLASTN 2.2.10 [Oct-19-2004]
Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.
Query= QCG16f05.yg.2.1
(585 letters)
Database: Hordeum_nucl_with_EST.fasta
312,970 sequences; 175,134,539 total letters
Score E
Sequences producing significant alignments: (bits) Value
gb|CA031681.1|CA031681 HX10N04r HX Hordeum vulgare subsp. v... 86 1e-015
gb|BU969636.1|BU969636 HB12B24r BC Hordeum vulgare subsp. v... 84 6e-015
>gb|CA031681.1|CA031681 HX10N04r HX Hordeum vulgare subsp. vulgare cDNA clone HX10N04
5-PRIME, mRNA sequence
Length = 518
Score = 85.7 bits (43), Expect = 1e-015
Identities = 136/167 (81%)
Strand = Plus / Minus
Query: 29 acgtccaaatttccctgaggacacaacttggttcttttagaactagatgcagaaagggaa 88
||||||||||| |||||||| |||| || |||| ||||||||| ||||| || || ||
Sbjct: 408 acgtccaaattgccctgagggcacagtttagttcgtttagaactggatgctgacagagac 349
Query: 89 tgagaaacagagacagaaccaccagctatctcgatttcccatggagatactctatcttgg 148
|||| || ||||| || || ||| ||||||| || ||||||||||||| ||||| ||||
Sbjct: 348 tgagcaatggagactgagccgccaactatctcaatctcccatggagatagtctattttgg 289
Query: 149 ccattacattcagcaccgtcctcccatcttaccagcaggcttctcca 195
|||||| ||| || |||||||| ||||||||||||||| ||||
Sbjct: 288 ttattacagtcaatgccatcctcccaccttaccagcaggcttttcca 242
Score = 46.1 bits (23), Expect = 0.001
Identities = 35/39 (89%)
Strand = Plus / Minus
Query: 301 tccaatacagactggatgattgaggctcttcaggaactt 339
||||||||| | |||| |||| |||||||||||||||||
Sbjct: 136 tccaatacaaaatggacgattcaggctcttcaggaactt 98
>gb|BU969636.1|BU969636 HB12B24r BC Hordeum vulgare subsp. vulgare cDNA clone HB12B24
5-PRIME, mRNA sequence
Length = 449
Score = 83.8 bits (42), Expect = 6e-015
Identities = 132/162 (81%)
Strand = Plus / Minus
Query: 29 acgtccaaatttccctgaggacacaacttggttcttttagaactagatgcagaaagggaa 88
||||||||||| |||||||| |||| || |||| ||||||||| ||||| || || ||
Sbjct: 162 acgtccaaattgccctgagggcacagtttagttcgtttagaactggatgctgacagagac 103
Query: 89 tgagaaacagagacagaaccaccagctatctcgatttcccatggagatactctatcttgg 148
|||| || ||||| || || ||| ||||||| || ||||||||||||| ||||| ||||
Sbjct: 102 tgagcaatggagactgagccgccaactatctcaatctcccatggagatagtctattttgg 43
Query: 149 ccattacattcagcaccgtcctcccatcttaccagcaggctt 190
|||||| ||| || |||||||| |||||||||||||||
Sbjct: 42 ttattacagtcaatgccatcctcccaccttaccagcaggctt 1
Database: Hordeum_nucl_with_EST.fasta
Posted date: Feb 7, 2006 2:16 PM
Number of letters in database: 175,134,539
Number of sequences in database: 312,970
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 37,675
Number of Sequences: 312970
Number of extensions: 37675
Number of successful extensions: 10507
Number of sequences better than 0.5: 2
Number of HSP's better than 0.5 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 10502
Number of HSP's gapped (non-prelim): 5
length of query: 585
length of database: 175,134,539
effective HSP length: 19
effective length of query: 566
effective length of database: 169,188,109
effective search space: 95760469694
effective search space used: 95760469694
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)